ID: 981340875

View in Genome Browser
Species Human (GRCh38)
Location 4:143619977-143619999
Sequence CTGAATATACAGATGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 687
Summary {0: 2, 1: 4, 2: 23, 3: 101, 4: 557}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981340872_981340875 20 Left 981340872 4:143619934-143619956 CCTTGCTGACATATCAACAAGTA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG 0: 2
1: 4
2: 23
3: 101
4: 557
981340871_981340875 21 Left 981340871 4:143619933-143619955 CCCTTGCTGACATATCAACAAGT 0: 1
1: 0
2: 2
3: 6
4: 204
Right 981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG 0: 2
1: 4
2: 23
3: 101
4: 557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981340875 Original CRISPR CTGAATATACAGATGGAAAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903054723 1:20627747-20627769 TTGAATGTAAAAATGGAAAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
904985872 1:34548249-34548271 CTGAATATAAAATTGTAAAATGG - Intergenic
906337819 1:44949404-44949426 CTGAATATACAAAGATAAAAGGG - Intronic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
907639082 1:56167470-56167492 CTGAATCTACAGGTGGGAAAGGG + Intergenic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909056340 1:70825522-70825544 CTGCAGATAGAGATGGAATAAGG + Intergenic
909506706 1:76399379-76399401 CTGAATAACCTCATGGAAAAAGG - Intronic
909923841 1:81414941-81414963 ATGAATAACCAGATGGGAAACGG - Intronic
910132205 1:83921593-83921615 CTGAAGATACAGAGACAAAATGG + Intronic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
913455580 1:119027145-119027167 CTGCATTTACAGATAGGAAATGG + Intergenic
913729570 1:121696006-121696028 TTGAACATTCCGATGGAAAAGGG - Intergenic
913729726 1:121697872-121697894 TTGAACATTCCGATGGAAAAGGG - Intergenic
913729882 1:121699738-121699760 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730039 1:121701604-121701626 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730195 1:121703470-121703492 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730503 1:121707202-121707224 TTGAACATTCTGATGGAAAAAGG - Intergenic
913730656 1:121709068-121709090 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730809 1:121710934-121710956 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731117 1:121714666-121714688 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731266 1:121716532-121716554 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731419 1:121718398-121718420 TTGAACATTCTGATGGAAAAGGG - Intergenic
913731723 1:121722129-121722151 TTGAACATTCTGATGGAAAAGGG - Intergenic
913731879 1:121723994-121724016 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732183 1:121727726-121727748 TTGAACATTCTGATGGAAAAGGG - Intergenic
913732339 1:121729591-121729613 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732492 1:121731456-121731478 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732639 1:121733321-121733343 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745110 1:121894434-121894456 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745265 1:121896300-121896322 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745489 1:121899002-121899024 TTGAACATTCTGATGGAAAAGGG - Intergenic
913745830 1:121903336-121903358 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745987 1:121905202-121905224 TTGAACATTCCGATGGAAAAGGG - Intergenic
913746625 1:121913010-121913032 TTGAACATTCCGATGGAAAAGGG - Intergenic
913748932 1:121939777-121939799 TTGAACATTCCGATGGAAAAGGG - Intergenic
913749704 1:121949095-121949117 TTGAACATTCTGATGGAAAAGGG - Intergenic
913749830 1:121950734-121950756 TTGAACATTCCGATGGAAAAGGG - Intergenic
913749983 1:121952599-121952621 TTGAACATTCCGATGGAAAAGGG - Intergenic
913750479 1:121959321-121959343 TTGAACATTCCGATGGAAAAGGG - Intergenic
913750633 1:121961187-121961209 TTGAACATTCCGATGGAAAAGGG - Intergenic
913751925 1:122027764-122027786 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752082 1:122029631-122029653 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752235 1:122031496-122031518 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752391 1:122033364-122033386 TTGAACATTCCGATGGAAAAGGG + Intergenic
913753716 1:122048636-122048658 TTGAACATTCCGATGGAAAAGGG + Intergenic
913755643 1:122071116-122071138 TTGAACATTCCGATGGAAAAGGG + Intergenic
913755800 1:122072981-122073003 TTGAACATTCTGATGGAAAAGGG + Intergenic
913756436 1:122080445-122080467 TTGAACATTCCGATGGAAAAGGG + Intergenic
913756919 1:122086216-122086238 TTGAACATTCCGATGGAAAAGGG + Intergenic
913757250 1:122089948-122089970 TTGAACATTCCGATGGAAAAGGG + Intergenic
913758420 1:122103555-122103577 TTGAACATTCCGATGGAAAAGGG + Intergenic
913759415 1:122115011-122115033 TTGAACATTCCGATGGAAAAGGG + Intergenic
913760040 1:122122479-122122501 TTGAACATTCTGATGGAAAAGGG + Intergenic
913761392 1:122137744-122137766 TTGAACATTCCGATGGAAAAGGG + Intergenic
913762033 1:122145211-122145233 TTGAACATTCCGATGGAAAAGGG + Intergenic
913763001 1:122156405-122156427 TTGAACATTCCGATGGAAAAGGG + Intergenic
913763335 1:122160136-122160158 TTGAACATTCCGATGGAAAAGGG + Intergenic
913764792 1:122177140-122177162 TTGAACATTCCGATGGAAAAGGG + Intergenic
913765276 1:122182739-122182761 TTGAACATTCCGATGGAAAAGGG + Intergenic
913765861 1:122189694-122189716 TTGAACATTCTGATGGAAAAGGG + Intergenic
913766187 1:122193596-122193618 TTGAACATTCCGATGGAAAAGGG + Intergenic
913768610 1:122221602-122221624 TTGAACATTCCGATGGAAAAGGG + Intergenic
913777900 1:122345615-122345637 TTGAATATTTCGATGGAAAAGGG + Intergenic
913780557 1:122381063-122381085 TTGAATATTTCGATGGAAAAGGG + Intergenic
913781962 1:122399730-122399752 TTGAATATTTCGATGGAAAAGGG + Intergenic
913784456 1:122432984-122433006 TTGAATATTTCGATGGAAAAGGG + Intergenic
913788803 1:122491194-122491216 TTGAATATTTCGATGGAAAAGGG + Intergenic
914217505 1:145645794-145645816 CTGAATATAATGTTAGAAAAGGG - Intronic
914470074 1:147968479-147968501 CTGAATATAATGTTAGAAAAGGG - Intronic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915961947 1:160274455-160274477 CTGATTATACATTTGGAAATGGG + Intergenic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
916235098 1:162579076-162579098 CTGAATAAACAGGAAGAAAAGGG - Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917387498 1:174492869-174492891 CTGCTTATACATATGGAAGAGGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917910991 1:179645943-179645965 CTAAATATAAAGATAGAGAAGGG - Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918205939 1:182309560-182309582 CTCAATATACTGATCAAAAAGGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918689015 1:187457099-187457121 ATGAATATACATATGGTACAAGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923775779 1:236977386-236977408 CTGCATCTTCAGATGGCAAAAGG + Intergenic
923880941 1:238103642-238103664 CTGAATTTACAGATGTGAAGGGG + Intergenic
923989208 1:239415973-239415995 CTGAATATACACATGGTAGCAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924743670 1:246813167-246813189 CTGAAAGAACTGATGGAAAAAGG + Intergenic
924859982 1:247910803-247910825 CGTAATATACAGAAGGAAAGAGG + Intergenic
1063222946 10:3987899-3987921 CTTAAGATAGACATGGAAAAAGG - Intergenic
1063429993 10:5979851-5979873 ATGGACATACACATGGAAAAGGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065417102 10:25500319-25500341 CTGCAGATAAATATGGAAAAAGG + Intronic
1066485021 10:35834961-35834983 CTGAATCCTCAGCTGGAAAAGGG + Intergenic
1066553323 10:36583639-36583661 CTGAATAGACAGTATGAAAAGGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067921599 10:50464315-50464337 CTGACTTTAAAGATGGAAAAGGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1070075656 10:73132489-73132511 CTGAAAATACTGATAGAAAGGGG + Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071007151 10:80895910-80895932 TTGAATATACAAATTTAAAAGGG - Intergenic
1071380474 10:85054107-85054129 CTGAAATTACAGATTTAAAATGG - Intergenic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074935555 10:118176589-118176611 CAGAATCTACAGATAGTAAAAGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075217326 10:120547647-120547669 CGATAAATACAGATGGAAAAAGG - Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079493650 11:21016698-21016720 ATCAATATACAGGTGGGAAAGGG - Intronic
1079566843 11:21892810-21892832 CTGAATGTGCAGTTGCAAAATGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1080377740 11:31733531-31733553 CTGACTCTACAGAAGTAAAAAGG + Intronic
1080915778 11:36657124-36657146 CTGAATATATTGGTGGAAACAGG + Intronic
1080944469 11:36956040-36956062 CTGAATATACAATTTGAAATAGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1082014652 11:47475782-47475804 CAGAATAGCCAGATAGAAAATGG - Intronic
1082301845 11:50515501-50515523 CCGAATATCCATTTGGAAAATGG + Intergenic
1085087590 11:73681290-73681312 CTGAGAATACAGATGTAACAAGG + Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087934405 11:104015800-104015822 ATGAAAATAGAAATGGAAAATGG - Intronic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091055391 11:132413451-132413473 ATGAGTATAGAGATGGAAAAAGG + Intergenic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092405016 12:8215132-8215154 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1093047008 12:14458383-14458405 ACAAATATATAGATGGAAAAGGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094755065 12:33458865-33458887 CTGATTCTACAGAAGTAAAAAGG + Intergenic
1094756817 12:33480571-33480593 CTGAATAGCCACATGCAAAAGGG + Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1095150858 12:38795362-38795384 TTGAATATACACATGGAAGTGGG - Intronic
1095660912 12:44734945-44734967 CTCAATATATGGAAGGAAAATGG - Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096021148 12:48326614-48326636 CTGATTTTAAAGATGGGAAAAGG + Intergenic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1096682770 12:53268028-53268050 CTGAAGATAAAGGAGGAAAAGGG + Intergenic
1098267905 12:68741353-68741375 TTGCTTATACACATGGAAAATGG - Intronic
1098539891 12:71642742-71642764 CTGTATAATCAGATAGAAAATGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1100343525 12:93704481-93704503 TGGAATATACAGAAGGAAAGAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104394627 12:128421870-128421892 GTGAACAGAGAGATGGAAAAAGG - Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106356006 13:28984016-28984038 CTGAACATAGAGCTGGAAACAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107098123 13:36558773-36558795 CTGGATTTACACATGGAAATGGG + Intergenic
1107461241 13:40605726-40605748 CTGACTAGAGAGGTGGAAAAGGG - Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1109498783 13:63211343-63211365 TTGAAAATACATATGGAAAATGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111583551 13:90255076-90255098 CTGAATGTTCAGATGTAAACTGG + Intergenic
1111637043 13:90919222-90919244 CTGATTATACAGAGGTCAAACGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112354252 13:98660991-98661013 CTGAATATACAGATGGCTCGTGG - Intergenic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112936414 13:104805275-104805297 ATGAATATAGAAATGGAAATTGG - Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116255756 14:42552778-42552800 CAGATTATACAGAGTGAAAAGGG - Intergenic
1116566707 14:46454695-46454717 CAGAATATTCAGATGTCAAAAGG + Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118250518 14:64155935-64155957 CCGAAGATACAGATCAAAAATGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1120470690 14:84919756-84919778 CTGAATCAACAGATGTGAAATGG + Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1121414260 14:93768174-93768196 CTGAACATTGAGGTGGAAAAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1126711072 15:51456776-51456798 ATGAATAAACAGATACAAAATGG - Intronic
1127196990 15:56597961-56597983 CTCAATATAAATATTGAAAAAGG + Intergenic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1127603886 15:60566863-60566885 CTCAATATAAGGATGGAAAGTGG + Intronic
1130033516 15:80337114-80337136 CTGAATATAAAGTTGGGAATGGG + Intergenic
1130840034 15:87689959-87689981 ATGAATATAGAGCTGGAGAATGG - Intergenic
1131823513 15:96296674-96296696 CTGAAACTATAGATGGAAACTGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136506576 16:30708049-30708071 CCGAAAATACAGACGGAAACTGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140845709 16:78885266-78885288 AAGAAAATACAGATGGAAGAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143916056 17:10293898-10293920 CTGAATGCAGAGATGGAAAGAGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148667169 17:49383366-49383388 CTGAATATTCCCATGGAAACTGG - Intronic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1148957310 17:51364520-51364542 CTGATTGTTCAGATGGAAAGTGG + Intergenic
1149349335 17:55771524-55771546 CTCAGTCTACAGAAGGAAAAAGG + Intronic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156135171 18:34028986-34029008 CTCAATAGAAGGATGGAAAAAGG - Intronic
1156474376 18:37396382-37396404 AAAAATTTACAGATGGAAAAAGG - Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157540549 18:48501098-48501120 CTGAATCTACAGATATTAAAAGG + Intergenic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158099617 18:53815732-53815754 CTGTAAATACAGATTTAAAATGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158667401 18:59444875-59444897 CTGATTAAAAAGATGGGAAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159114455 18:64098172-64098194 CTGAATATTGACATAGAAAAAGG - Intergenic
1159361430 18:67409173-67409195 GTGAATAGAGAGATGGAAACTGG + Intergenic
1159553266 18:69918825-69918847 TGGAAAATACAGATGGAAAGTGG + Intronic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160681772 19:414952-414974 ATGGATGGACAGATGGAAAATGG + Intergenic
1161639032 19:5408336-5408358 CTGGATATCCACATGCAAAAGGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165340469 19:35208218-35208240 CTGAAAATACAGAAAGGAAATGG + Intergenic
1166237073 19:41464396-41464418 CTTAATATCCAGAAGGAAAGAGG - Intergenic
1166238222 19:41471873-41471895 CACAATATTCAGAGGGAAAAAGG - Intergenic
1166243685 19:41510819-41510841 CAGAATATCCAGAGTGAAAAAGG - Intergenic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928131267 2:28652877-28652899 CTGCACATACAGTTGGAAGATGG - Intergenic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928361634 2:30666744-30666766 CAGTATTTACAGATAGAAAAAGG - Intergenic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
929678005 2:43957085-43957107 CTGAACATACATATGCAAATTGG + Intronic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
930963440 2:57289505-57289527 TTCACTATAAAGATGGAAAACGG + Intergenic
931297348 2:60941017-60941039 TTTAATATAGAGATGGGAAATGG + Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933254841 2:80069172-80069194 CAGAACATAAAGGTGGAAAAAGG - Intronic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
933706485 2:85294730-85294752 CTGTATGTACAGTTGTAAAAGGG - Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938575765 2:132602697-132602719 CTGAATAATCTGATGTAAAATGG + Intronic
938771411 2:134504394-134504416 ATGAATATACACATGGATGATGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941268571 2:163395875-163395897 CAGAATATAAAAATTGAAAAGGG + Intergenic
941425220 2:165335938-165335960 TTGAATAGACATATTGAAAAAGG + Intronic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942519615 2:176790053-176790075 AGGAAGATAGAGATGGAAAATGG - Intergenic
942706100 2:178774367-178774389 CAGAAAATATAGAAGGAAAATGG - Exonic
942867120 2:180690356-180690378 CTGAACAAACGGATAGAAAATGG + Intergenic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
943842827 2:192602267-192602289 CTAAATATACAGGTTGAAAGAGG + Intergenic
943922978 2:193733739-193733761 TTGAATAGACAGATGTAACAAGG + Intergenic
944189566 2:196987402-196987424 CAGAATATACAAATATAAAAAGG + Intronic
944383123 2:199134804-199134826 ATGAATTCACAGATGCAAAATGG + Intergenic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
944969207 2:204972675-204972697 TAGAAAATACAGCTGGAAAAAGG - Intronic
945052158 2:205834391-205834413 CCGAAAACACAGAGGGAAAAGGG - Intergenic
945501566 2:210581972-210581994 CTCAAGATACAGCTGAAAAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945902309 2:215552791-215552813 CTGAATATACTGAGGGTATAAGG - Intergenic
948507908 2:238442749-238442771 CTGGACATCCATATGGAAAAAGG - Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170066069 20:12311851-12311873 CTGAATATAGAGAAAGCAAATGG - Intergenic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170708135 20:18764636-18764658 TGGAATATAGAGTTGGAAAAGGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172601390 20:36186011-36186033 GTGCATATACAGGTGAAAAATGG - Intronic
1172725468 20:37037324-37037346 ATGAATATACAAATGTAAAGCGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1178152403 21:29810534-29810556 CTGAGTTTAAAGAAGGAAAATGG - Intronic
1178341132 21:31786007-31786029 CTGAATTTACCGAAGGAAAGGGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182114557 22:27748199-27748221 CTGAAGAGACTGATGTAAAAAGG + Intergenic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1183117302 22:35701901-35701923 CTAAATATACAGGTTGAAAGAGG - Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
951700755 3:25494231-25494253 CGTAAGATACAGCTGGAAAAGGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
952685181 3:36139408-36139430 TTGAATATAGAAAGGGAAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953332747 3:42067832-42067854 TTGAAAATTCACATGGAAAAAGG - Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
955079396 3:55644181-55644203 CTCATTTTACAGATGGTAAAAGG - Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956827181 3:73008282-73008304 TGGAATATACAGAAGCAAAAGGG - Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
957955075 3:87176005-87176027 CTGGTTATACAGATAGAAAATGG - Intergenic
957978951 3:87482917-87482939 ATTAATCTACAGATAGAAAATGG - Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
962737724 3:138340554-138340576 CTGAATTTACTGATAGGAAATGG - Intergenic
963305099 3:143642766-143642788 CAGAATATAAAGTTGGCAAATGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965241392 3:166203663-166203685 CTGATGTTACAGATGTAAAAGGG + Intergenic
965315568 3:167185821-167185843 ATTAATGTACATATGGAAAATGG - Intergenic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
965746033 3:171927139-171927161 CTGCATCTACAGAATGAAAAAGG + Intronic
965833319 3:172823107-172823129 ATGAATAGAAAGATGTAAAAAGG + Intergenic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966563607 3:181350903-181350925 CTAGATATATAAATGGAAAAGGG + Intergenic
967498469 3:190169103-190169125 CTGAATCTACAGTTTAAAAAAGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970287843 4:14538171-14538193 CTTATTATACAGACAGAAAATGG - Intergenic
970338136 4:15074508-15074530 CTGCATATACAGTTAGAAAAAGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
975961698 4:79916679-79916701 ATTAAGATACAGATAGAAAATGG + Intronic
976142371 4:82005765-82005787 CTGAATATACACATGCCAGAGGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976796169 4:88935504-88935526 ATGAATATAAAGATAGGAAATGG - Intronic
976927493 4:90517571-90517593 TTGAATATACAGATTTAAACTGG + Intronic
977073344 4:92421368-92421390 GAGGAAATACAGATGGAAAAAGG + Intronic
977181722 4:93883223-93883245 AAGAATATACAGACTGAAAAAGG - Intergenic
977239249 4:94546841-94546863 TTGAATATTCAGGTTGAAAAAGG - Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
979147954 4:117269591-117269613 TTGAAGAAACAGTTGGAAAATGG + Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980461990 4:133126182-133126204 ATGAGGATACAGATGGAAACAGG + Intergenic
980593912 4:134928119-134928141 CTAAAGATAAAGATAGAAAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982263008 4:153511656-153511678 ATACATATATAGATGGAAAAAGG - Intronic
982387787 4:154831099-154831121 CTGAATAGGCAGATGACAAATGG + Intergenic
983004110 4:162461322-162461344 GTGAGTAGAAAGATGGAAAAGGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
985897464 5:2757310-2757332 CCGAATTTACAGTTGGCAAAGGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986417134 5:7540445-7540467 CGGAAATTAGAGATGGAAAAAGG - Intronic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986888992 5:12277160-12277182 CTGAATAGACTTATGGAAAGAGG + Intergenic
987528682 5:19086161-19086183 GTCAATATACACATGGAAAATGG - Intergenic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
992536068 5:77704992-77705014 CTACATACACAGATGTAAAAGGG - Intronic
992553819 5:77884416-77884438 CTGTATATACAGAGTGAGAAAGG + Intergenic
992623818 5:78618814-78618836 TTGAACATACACATTGAAAAAGG + Intronic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993146341 5:84098191-84098213 CTGAACATATAAATGTAAAATGG + Intronic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997495796 5:134324059-134324081 GAAAATATACAGATGGCAAATGG + Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
997684638 5:135780077-135780099 CTTAATATACAGGGGAAAAAAGG + Intergenic
997831770 5:137156594-137156616 GTGAATATACATGTTGAAAAGGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999267145 5:150274112-150274134 CTAAAGAGACAGGTGGAAAATGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001358488 5:171056900-171056922 CTGAATAAACTGTAGGAAAAAGG - Intronic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1002870076 6:1158782-1158804 CTAAATACACAGTTGTAAAAGGG + Intergenic
1003798409 6:9632006-9632028 TTAAAATTACAGATGGAAAAGGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004850025 6:19689902-19689924 CTGAATATTAACATTGAAAATGG + Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008629099 6:53347439-53347461 CAGAATCTACAGATAGAAACAGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009367999 6:62870520-62870542 CCTAATATCCAGATGGAAAGAGG + Intergenic
1009368081 6:62871264-62871286 CTTAATATCCAGAAGGAAAGAGG + Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009868761 6:69430687-69430709 CTGAAATTTCGGATGGAAAAGGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015641868 6:135343076-135343098 TAGAATATACAGATTCAAAAAGG + Intronic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1015710232 6:136131047-136131069 CTGAATATACAGAATGGATATGG - Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016766656 6:147801852-147801874 CTAAATATCCATAGGGAAAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018319344 6:162590542-162590564 CAGAAGATTCAGATGGAAAGTGG - Intronic
1018995798 6:168709676-168709698 CTGGGTTTAGAGATGGAAAACGG - Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020728327 7:11844852-11844874 CTGAATATAGAGTTTTAAAAGGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1020992763 7:15221172-15221194 CTCAATATCCAGAAGGTAAAAGG - Intronic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022618612 7:31958481-31958503 CTGGATATTCAGATTGCAAAAGG - Intronic
1023776424 7:43612045-43612067 CTGAATATACTGAGGAGAAAGGG - Intronic
1023913495 7:44571436-44571458 TTGAAGATAGAGATGGAAAGGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1024781198 7:52851201-52851223 TTGAATCTATAAATGGAAAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1028050782 7:86182884-86182906 CTAAATCTACAAATTGAAAAGGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029801493 7:102952504-102952526 CTGACTTTACAGAAGTAAAAAGG + Intronic
1030865282 7:114695167-114695189 CTGAACATACGGAGGGTAAAGGG - Intergenic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031329845 7:120451034-120451056 ATCAATAGACAGAAGGAAAAAGG - Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1032259134 7:130320707-130320729 AAGGAAATACAGATGGAAAATGG - Intronic
1032684168 7:134213864-134213886 TTGTAAATATAGATGGAAAATGG - Intronic
1032750889 7:134840247-134840269 ATGAATATCTATATGGAAAAAGG - Intronic
1034001999 7:147424618-147424640 GTCAACATACAGATGGAATATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1036271211 8:7304694-7304716 CTGAATTTAAAGAAAGAAAAAGG - Intergenic
1036293505 8:7516904-7516926 TTAAATATAAAGATGGATAAAGG + Intergenic
1036329054 8:7804091-7804113 TTAAATATAAAGATGGATAAAGG - Intergenic
1036350138 8:8005649-8005671 CTGAATTTAAAGAAAGAAAAAGG + Intergenic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041344050 8:56877191-56877213 CTGAATCTAAGGAAGGAAAATGG - Intergenic
1041367253 8:57120758-57120780 CTGAATATTTAGCAGGAAAAAGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1042548990 8:69976208-69976230 CAGCATATAGAGAAGGAAAAGGG + Intergenic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044304958 8:90628373-90628395 CTGACAATAAAGATGGAAACAGG + Intronic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045190909 8:99882700-99882722 CTGATTTTACAGATCTAAAAAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046584034 8:116129584-116129606 TGGAATATAAAGATGGAAAGGGG + Intergenic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1050902812 9:10967214-10967236 CTTAATATACAGGTTGAAAGAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051062845 9:13065092-13065114 ATGCCTATACTGATGGAAAAGGG - Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052479358 9:29003045-29003067 GTGAAAATACGGATAGAAAATGG + Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052957514 9:34264885-34264907 CAGCATATACAACTGGAAAAAGG + Intronic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1053010172 9:34628392-34628414 GTGAAAATAGAGATGGAACAGGG + Intergenic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG + Intergenic
1054690519 9:68318565-68318587 CTAAATATACAGCTTGAAAAAGG - Intergenic
1054719171 9:68586423-68586445 CTGTATATACATATATAAAATGG - Intergenic
1054895670 9:70308247-70308269 CTAAATATACTGATGGTAAGGGG - Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1056785278 9:89588195-89588217 CTGATTGTACAGATGTTAAAAGG + Intergenic
1058166171 9:101621768-101621790 CTGAAGATAAAGGTGGAAAATGG + Intronic
1058521703 9:105818921-105818943 CTAAATATACAGGTTGAAAGAGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059443492 9:114324049-114324071 CTGAATGTCCAGCGGGAAAATGG + Exonic
1059761567 9:117342688-117342710 CTGAAAACACAGTTTGAAAATGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1203338948 Un_KI270302v1:2246-2268 TTGAATATTTCGATGGAAAAGGG + Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1186605600 X:11087065-11087087 TTAAATATAAAGATGGAAATAGG - Intergenic
1186622880 X:11260113-11260135 CTAGCTTTACAGATGGAAAAAGG + Intronic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1188149893 X:26659930-26659952 CTGAATATTCATGTGCAAAATGG + Intergenic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189586147 X:42463916-42463938 CTGAAAATACATATGGAAACAGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190469771 X:50766718-50766740 TTGAATATATAAATGTAAAAAGG + Intronic
1190871635 X:54429743-54429765 CTGGTTATACAGATGGGAGAAGG - Intergenic
1191724885 X:64268895-64268917 CTGAATACCCTGATGGAGAATGG - Exonic
1192193545 X:69013741-69013763 CAGACTATATAGATGGGAAATGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194523808 X:94951035-94951057 TTGGCTATAGAGATGGAAAAAGG + Intergenic
1194909919 X:99629746-99629768 CTGTATATACAGTTGGGAAGAGG - Intergenic
1195304945 X:103572773-103572795 CTGAATTTACAAGAGGAAAATGG - Intergenic
1197851584 X:130867269-130867291 GTAAATATATAGTTGGAAAATGG + Intronic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199474304 X:148228984-148229006 CTCATTATACTGATGGAAAGAGG + Intergenic
1200781877 Y:7224108-7224130 ATGAATATAAACATGGAACATGG - Intergenic
1200849637 Y:7869726-7869748 ATGAATACACAGAGAGAAAAAGG + Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic