ID: 981343249

View in Genome Browser
Species Human (GRCh38)
Location 4:143647051-143647073
Sequence TAAAATGTTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 5, 2: 51, 3: 125, 4: 446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981343247_981343249 4 Left 981343247 4:143647024-143647046 CCTAGAGACTTGTTGAATGGCTT 0: 1428
1: 1886
2: 1423
3: 807
4: 580
Right 981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG 0: 1
1: 5
2: 51
3: 125
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981343249 Original CRISPR TAAAATGTTGATAGTGATAT GGG Intronic
901343759 1:8519721-8519743 TAAAATCCTGACTGTGATATGGG - Intronic
903513249 1:23892279-23892301 TAAAATCTCTCTAGTGATATAGG + Intronic
903548158 1:24140167-24140189 TCAAATGGGGATAGTGATAGTGG - Intronic
904405016 1:30282641-30282663 TAAAGTGTTCTTAGAGATATTGG - Intergenic
904768500 1:32868502-32868524 TAAAATGGAGATATTGATAGCGG - Intronic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
906813479 1:48853055-48853077 TAAAATGTTTATTATGATCTAGG - Intronic
906955296 1:50369139-50369161 TATAATGATGATAGTGATGATGG + Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909798335 1:79772754-79772776 TAAAATGAGGATAGTGACTTTGG + Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
910487564 1:87732293-87732315 TAGAATATTAATAGTCATATAGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
913031966 1:114916462-114916484 TAAAATGTTTTAATTGATATTGG + Intronic
913417488 1:118627278-118627300 TCAAATGTTGATAGGAATGTGGG + Intergenic
913973503 1:143435166-143435188 TAAAATAGGGATAGTGATACTGG + Intergenic
914067891 1:144260773-144260795 TAAAATAAGGATAGTGATACTGG + Intergenic
914111264 1:144705581-144705603 TAAAATAAGGATAGTGATACTGG - Intergenic
915730560 1:158050911-158050933 TAAAGTGTAGATAGTGAGACCGG - Intronic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
916532219 1:165667916-165667938 AAAAATGTTGATAGTTTTGTAGG - Intronic
916584580 1:166139503-166139525 TAAAATGGCCATAGTGATAGAGG + Intronic
916777880 1:167987805-167987827 TAAAATGTTAATATTGAAGTTGG + Intronic
916972256 1:170035209-170035231 TAAAATTTGGATAGTAATAGTGG - Intronic
919076640 1:192821690-192821712 TATAAGGTTGATAGTGATCTAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919493155 1:198230215-198230237 TGAAATGTTGATTTTAATATTGG + Intronic
919557762 1:199081890-199081912 TAAAATGTGGTTAGTGAAAAGGG - Intergenic
920368725 1:205463485-205463507 TATAAAGATGATAGTTATATTGG + Intergenic
920520664 1:206622609-206622631 TAAAATGTTGATTGTGGTGATGG - Intergenic
921059386 1:211570347-211570369 AAAATTATTGATAGTGAAATTGG + Intergenic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921316520 1:213896773-213896795 CAAAATTTTAATAGTGGTATTGG - Intergenic
921774903 1:219086098-219086120 TAAAATGTAGAAAGTGAAGTAGG - Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922638705 1:227204636-227204658 TGAAATGCTGTTAGAGATATTGG - Intronic
923800240 1:237202017-237202039 TAAAATGTTCGTAGAGAAATGGG + Intronic
1063313306 10:4977189-4977211 TAAATTGTTGTTTTTGATATAGG - Intronic
1065625927 10:27628184-27628206 TAAAATACTGACAGTGATAATGG + Intergenic
1065708513 10:28493337-28493359 TAAAATATTGATAAAGAGATTGG - Intergenic
1066069583 10:31793755-31793777 TCATATTTTGATAGGGATATGGG - Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067181952 10:43994695-43994717 GATAATGGTGATGGTGATATTGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068156359 10:53204922-53204944 GATAATGTTGATAGTGGTGTAGG + Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1068298859 10:55112675-55112697 TAACATGCTGATCGTCATATGGG - Intronic
1068778384 10:60892167-60892189 TAAAATGTCGATATTGATTTTGG - Intronic
1068877557 10:62012794-62012816 TAAAATGTTTATAAGAATATGGG - Intronic
1068971915 10:62967943-62967965 TATAATGTTGATTGTGCTGTTGG - Intergenic
1071208013 10:83306052-83306074 TAATATGTTGATGATGATAATGG - Intergenic
1072067028 10:91881262-91881284 TAGAATGTGATTAGTGATATAGG + Intergenic
1072360270 10:94652712-94652734 TAAATTGTTGATAGTGAAGTGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073386958 10:103133805-103133827 AAAAATATTGATAGTGACATGGG + Intronic
1074633300 10:115283596-115283618 TAAGAAGTTGAAAGTGGTATTGG + Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1077876163 11:6308569-6308591 CAAAATGTTAATAGTGATGAGGG - Intergenic
1078358625 11:10651418-10651440 TAAAATGTTGATTTTGGTGTGGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078705513 11:13740116-13740138 TAAAATCTTGAAATTGATCTAGG + Intergenic
1079279396 11:19073780-19073802 TAAAAAGGTGATAGTGATACAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079807415 11:24950979-24951001 TAAAATGTTGAAAGACAAATTGG - Intronic
1079827092 11:25210956-25210978 TAAAATTTTAATAGTTATATCGG + Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080572909 11:33572382-33572404 TAGAACCTAGATAGTGATATGGG - Intronic
1080729080 11:34929893-34929915 TCAAATGCTGATAGTTACATTGG + Intronic
1081028102 11:38041002-38041024 AGAAATGTTAATAGAGATATGGG + Intergenic
1081099198 11:38981259-38981281 TAAATTGTTGATATTGTTTTTGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081160802 11:39745438-39745460 TAAAATGTTACCAGGGATATGGG - Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1082149727 11:48721784-48721806 TAGAATCTGGAAAGTGATATTGG + Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082941804 11:58712972-58712994 TAAAATATTGGTAGTTTTATTGG + Intronic
1085863935 11:80266043-80266065 TATAATGATGATAGAGATAATGG + Intergenic
1086574795 11:88327460-88327482 TAAAATGTTGATGAAGAAATAGG - Intronic
1086772671 11:90788192-90788214 TAAAATCTTGCTAGAGATAAAGG - Intergenic
1086802826 11:91198516-91198538 TTCAATGTTGATAATGATATAGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087494380 11:98871494-98871516 TTAACTGTTTTTAGTGATATAGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088158582 11:106840173-106840195 AAAAATGATGATATTGTTATTGG + Intronic
1088181111 11:107112721-107112743 TAAGGTGTTGAGAGTGAAATAGG - Intergenic
1088563874 11:111146877-111146899 TAAAAAGTTGATATTGATATAGG + Intergenic
1088873360 11:113911835-113911857 TGATATCTTGATAGAGATATGGG - Intronic
1089512619 11:119009711-119009733 AACACTGTTGATAGTGGTATTGG + Intronic
1090148359 11:124353527-124353549 TAAACTGTTGATAGACATCTAGG + Intergenic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092564734 12:9652108-9652130 TAAAATATTGATAATGCTTTTGG + Intergenic
1093002237 12:14010310-14010332 TAAAATGTGGGCAGTGATTTTGG + Intergenic
1093350043 12:18087912-18087934 TAAAATGTTCATAATGTCATAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095252398 12:39994501-39994523 TATTATGGTGGTAGTGATATGGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095617760 12:44212895-44212917 TTAAATGTTGCTGGAGATATAGG + Intronic
1095804439 12:46303021-46303043 TCAAATATTGATGATGATATTGG - Intergenic
1096564494 12:52467285-52467307 TAAAATGTCTCTAGTGATGTGGG + Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097696124 12:62776386-62776408 TAAAATGTTGAGTATGCTATTGG - Intronic
1097852263 12:64423797-64423819 TAAAATATTGATAATATTATTGG + Intronic
1098095031 12:66945842-66945864 TAAAATGTTGAGGAGGATATTGG - Intergenic
1098305714 12:69100530-69100552 AAAAATGTAGACACTGATATGGG + Intergenic
1099387429 12:82031552-82031574 TTAAATATTGATGGCGATATAGG + Intergenic
1099422312 12:82476451-82476473 TAAAATTTTTACACTGATATAGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102354449 12:112221200-112221222 TAAAGTGTTGGTAGTGAAAACGG + Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106114846 13:26808558-26808580 AAAAATGTTGTAAGAGATATAGG + Intergenic
1107227858 13:38072618-38072640 TAAAATGTGGTTGGGGATATGGG - Intergenic
1107384419 13:39892903-39892925 TAAAATGTTGGAAATAATATGGG - Intergenic
1107746806 13:43519286-43519308 TATAAGGTTGATGGTGAGATTGG - Intronic
1108860161 13:54847567-54847589 TAAAATGTTCATAGTCTCATAGG + Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109978603 13:69874579-69874601 TAAAATGATGACATTAATATAGG - Intronic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110096107 13:71523173-71523195 TGAAATGTTGTTTGTGACATAGG - Intronic
1110803567 13:79728703-79728725 AAAAATGTTGGTAGTGTGATAGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111647158 13:91045983-91046005 GAAAATGTTAATAATTATATTGG - Intergenic
1112068705 13:95823756-95823778 TTCAATGTTAATAGAGATATGGG + Intronic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1112162439 13:96882844-96882866 TAAATTGTTGATAGGCATTTGGG + Intergenic
1112817367 13:103288550-103288572 TAAAATGTTGATTTGGGTATGGG - Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114235327 14:20818700-20818722 TAAAATGTTAATAATGTTGTAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114887765 14:26875693-26875715 TAAAATGTTGTTAGTAATGGTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115401660 14:32968455-32968477 TAAAATTCTGAAGGTGATATAGG + Intronic
1115804132 14:37032097-37032119 TAACATGTAGATAGCTATATGGG - Intronic
1115884551 14:37956690-37956712 AAAAAAATTGATACTGATATAGG - Intronic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117155008 14:52930404-52930426 TAGAGTGTTGCTAGTCATATAGG - Intronic
1117783892 14:59262573-59262595 GAAAATGTTGAAAATGCTATAGG - Intronic
1119691966 14:76680234-76680256 TAAAATGGTGAAAGTGTTACAGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120319377 14:82940133-82940155 TAAAATGTTTAAAGTAGTATGGG - Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120678884 14:87455280-87455302 TTCAATGTTGATAGAAATATTGG - Intergenic
1121987842 14:98525720-98525742 GAAAATGTTTATAGGGAGATTGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124195883 15:27628660-27628682 TTTAATGTTGTTACTGATATGGG - Intergenic
1125453342 15:39831882-39831904 TAAAATACTGAGAGTGATAAGGG - Intronic
1126420746 15:48469723-48469745 AATGATGTTGATAGTGATCTGGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126613443 15:50552521-50552543 TAAAATATTGAAAGTGATTCAGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1126923737 15:53558183-53558205 TAAAATGTTAAAATTAATATTGG - Intronic
1127559825 15:60125078-60125100 TGAAATGTTCATAATGAGATGGG + Intergenic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1130438881 15:83930728-83930750 TCAAAGGTTGAGAGTTATATTGG + Intronic
1130696087 15:86132961-86132983 TAAAATGTTGATAAATAAATAGG - Intergenic
1130724997 15:86429984-86430006 TAAAATGTTGGAATTGAAATAGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1133142328 16:3755732-3755754 TAAAATGTTTCTATTGATAAAGG + Intronic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1135606209 16:23827027-23827049 TTAAATGTTGATAGTTACTTGGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1137229214 16:46546902-46546924 TCAAATGTTTATAGAAATATAGG - Intergenic
1137258842 16:46804698-46804720 TTATATGTTGATTGTGACATGGG - Intronic
1138098164 16:54230057-54230079 TAAAATGTTGATATTTTTATCGG - Intergenic
1138856825 16:60704071-60704093 TATAACGTAGATAGTGATAATGG - Intergenic
1138919939 16:61515192-61515214 TATAATTCTTATAGTGATATAGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139117275 16:63971708-63971730 TAAAAGGTTTATAATAATATTGG - Intergenic
1139214066 16:65110214-65110236 TAGAATGTTGAGAGTCAGATAGG - Intronic
1140254088 16:73319948-73319970 TAAAATGATGAGAGTGAACTCGG + Intergenic
1140870903 16:79105497-79105519 TTAAATATAGATATTGATATGGG - Intronic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1142942853 17:3397408-3397430 TAAAATATTGATATTAATATTGG - Exonic
1143201912 17:5119088-5119110 TAAATACTTGATAGTGATAGAGG - Intronic
1144160420 17:12552318-12552340 GATAATCGTGATAGTGATATTGG - Intergenic
1147006060 17:37405211-37405233 TAAAAGGATAAGAGTGATATGGG - Intronic
1147456209 17:40539778-40539800 TAAAATGTTAATAGCAATAAAGG + Intergenic
1150989944 17:70245553-70245575 TAAAATGATGATAATGATAATGG - Intergenic
1153328618 18:3848751-3848773 TAGGATGGTGACAGTGATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156799567 18:41093072-41093094 TAAAATGGGGATAGTGAGAATGG - Intergenic
1157261121 18:46176105-46176127 TCTAATATTAATAGTGATATTGG + Intronic
1157712652 18:49860416-49860438 TAAAATGGTGATAATGATGCTGG + Intronic
1157958894 18:52130349-52130371 TAAAATGTTTATTGTCATTTAGG + Intergenic
1159280263 18:66275797-66275819 TAAAATATTGATATAAATATTGG - Intergenic
1159687395 18:71439366-71439388 AAAAATGTTAAGAGTGATAAAGG + Intergenic
1160010266 18:75101965-75101987 TGAAATGTTGATAGAAATATGGG - Intergenic
1162861561 19:13509330-13509352 GAAAATCTTGAAAGTGCTATGGG - Intronic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1166431286 19:42730019-42730041 TAAGTTGTTGATGGTGATGTAGG + Exonic
1166434410 19:42755229-42755251 TAAGTTGTTGATGGTGATGTAGG + Exonic
1166447264 19:42868997-42869019 TAAGTTGTTGATGGTGATGTAGG + Exonic
1166463970 19:43016008-43016030 TAAGTTGTTGATGGTGATGTAGG + Intronic
1166470128 19:43072592-43072614 TAAGTTGTTGATGGTGATTTAGG + Intronic
1166483728 19:43195236-43195258 TAAGTTGTTGATTGTGATGTAGG + Exonic
1166490843 19:43259098-43259120 TAAGTTGTTGATGGTGATGTAGG + Exonic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925570949 2:5312238-5312260 TAAAATGGGGAAAGTGATGTTGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926375249 2:12220784-12220806 TAAAGTGTTGGTAGTGATGTGGG - Intergenic
926628239 2:15113080-15113102 AATTATGTTGATGGTGATATTGG + Intergenic
926824915 2:16896381-16896403 TAGAATGATGATAGAGACATGGG - Intergenic
928346613 2:30503325-30503347 ATAAATGTTCATAGTGAGATAGG - Intronic
928966696 2:36983225-36983247 TACAATGTTAATAGTATTATAGG + Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929221741 2:39471777-39471799 GAAAATGTTGGCATTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929695198 2:44108807-44108829 TAAAATGTTGATAGGTATAACGG + Intergenic
929711739 2:44273203-44273225 TTAAATGATGATAGTTATCTGGG - Intergenic
929725928 2:44427808-44427830 TAAAAATGTGATAGTGAAATGGG + Intronic
930713123 2:54567917-54567939 TAGAATTTTGAAAGTGAAATAGG + Intronic
930909958 2:56619404-56619426 TAAATTGTTGATAGTGTAGTGGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931333176 2:61309781-61309803 TAAAATGTTGATAAAAATACTGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
934178200 2:89596132-89596154 TAAAATAGGGATAGTGATACTGG + Intergenic
934288497 2:91670424-91670446 TAAAATAGGGATAGTGATACTGG + Intergenic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG + Intronic
938007545 2:127800295-127800317 TTAAGTGTTGATGGTGATTTGGG - Intronic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938440336 2:131325237-131325259 TCAAATCTAGATAGTGAAATTGG + Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939906606 2:147923904-147923926 TAAAATATTGTTAGTAACATAGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
941171209 2:162139755-162139777 TCAAATGTAGATTCTGATATGGG + Intergenic
941204202 2:162551104-162551126 TAAAATGTTGAATTTGATCTTGG - Intronic
941541097 2:166785602-166785624 AAAAATGTTAATAGAGATAAGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942006780 2:171710222-171710244 TAATATTGTGATGGTGATATTGG + Intronic
942844475 2:180406103-180406125 TAAAATTTTGCCAGTGATAATGG - Intergenic
942905638 2:181177271-181177293 TAAAATGTTCACAGTGAAATTGG - Intergenic
943644314 2:190392293-190392315 CAAAATGTCAATAGTGATAAAGG - Intergenic
944048999 2:195445226-195445248 AAAAAAGTTGATACTGATTTTGG - Intergenic
944306631 2:198187093-198187115 TAAAATGTTTAGAGGGCTATGGG - Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947679540 2:232017526-232017548 TAAAATGGTGTTTGGGATATGGG - Intronic
948330939 2:237164708-237164730 AAAATTGTTGAAAGTGAGATTGG + Intergenic
949049439 2:241889142-241889164 TAAATTGTTCATAGAAATATAGG + Intergenic
1169711314 20:8567292-8567314 TAAAATGTTGACTCTGATACAGG + Intronic
1169792266 20:9423886-9423908 AAAATTGTTGGTAGTGATAATGG - Exonic
1169884587 20:10384373-10384395 TAAAATGTGTGAAGTGATATGGG + Intergenic
1170199241 20:13724762-13724784 TAACATGCTGAAAGTCATATGGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1173211094 20:41032359-41032381 TAAAATGTTGACAGTGAGTTAGG + Intronic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1173968906 20:47135451-47135473 AATAATGTTGATAATGATAATGG - Intronic
1174784453 20:53419506-53419528 TAAAATGGAGCTAGTGATAATGG - Intronic
1175596936 20:60242812-60242834 TAAAATGATCATCTTGATATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176704231 21:10099171-10099193 TAAAATGATAATACTAATATTGG - Intergenic
1177244837 21:18509920-18509942 CAATATGTTGACAGTGAAATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177517323 21:22172011-22172033 TAGCATGTTGATAGTCATGTAGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177605689 21:23375309-23375331 AAAAATGTTCATAGTGAGTTGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177754475 21:25329455-25329477 TAAAATGATGATTCAGATATAGG - Intergenic
1178030800 21:28523198-28523220 TTAAAAGTTGCTAGTGATATTGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1178806453 21:35843735-35843757 TAAAATGTAGCTAGTGATCTTGG + Intronic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
1182537078 22:31012429-31012451 TAAGATGTTAATAGGGAAATTGG + Intergenic
1182721035 22:32400446-32400468 TGAAATAATGATAGTGAAATGGG - Intronic
949220861 3:1632458-1632480 TAAAAAACTGAGAGTGATATAGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951011496 3:17686904-17686926 TAAAATGTTAGTAGTGATGAGGG + Intronic
952128246 3:30328773-30328795 TGAAATGTTGATAGTTATGGAGG + Intergenic
955511324 3:59683337-59683359 TAAAGTATTGTTAGCGATATGGG + Intergenic
956262309 3:67357605-67357627 TAAAATATTTATAGTTAAATAGG + Intergenic
956397062 3:68837301-68837323 TAAAATGTTGATTCTGATTCAGG - Intronic
956510561 3:69988842-69988864 TAAAATGGAGATAGCTATATAGG - Intergenic
956758734 3:72417684-72417706 TAAAATGTTGCTTGTGTAATTGG - Intronic
957418124 3:79931943-79931965 AAATATGTTGAAAGTGTTATAGG - Intergenic
957503267 3:81085672-81085694 TAATAAGGTGATAGAGATATAGG - Intergenic
958113833 3:89188567-89188589 CAATATGTAGATGGTGATATTGG - Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958187367 3:90139332-90139354 TAAAATGTTTTTATAGATATGGG - Intergenic
958583342 3:96053796-96053818 AAAAATGTGGATAGTGATGTGGG - Intergenic
958680538 3:97325137-97325159 TAAAATGGGGATAATAATATAGG + Intronic
959124169 3:102270245-102270267 TATAATGCTGATAATGTTATTGG + Intronic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959265300 3:104129809-104129831 TTAAATGTTGATTCTGATACTGG - Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
959807337 3:110573154-110573176 TAAAATGTTTATTGTGCTCTCGG + Intergenic
960647237 3:119899921-119899943 TAAACTTTTGATTGTGCTATGGG - Intronic
961023991 3:123536139-123536161 TAAAATTTACATATTGATATAGG - Intronic
962109685 3:132431307-132431329 TAGAATGTGGAAAGTGCTATGGG + Intronic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964219445 3:154326967-154326989 GAAAATGGTGAGAGTGTTATGGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965265854 3:166542359-166542381 TAAAATGGTGATAATGAAAAAGG + Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
965541379 3:169875010-169875032 GAAAATGTTGATGGTGAAGTGGG + Intergenic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966314408 3:178629583-178629605 TACAATGATGATTGTGATCTTGG - Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966867696 3:184269098-184269120 TAAAATATGGACAATGATATTGG + Intronic
967243672 3:187465862-187465884 TAAAATGGTGATATTGAAACTGG - Intergenic
967634931 3:191790412-191790434 TACAATGTGGGTAGAGATATTGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969541764 4:7795753-7795775 TGAAATGGTTATAGTGACATAGG - Intronic
969831050 4:9797264-9797286 TAAAATAAGGATAGTGATACTGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971601823 4:28601789-28601811 AAAAATGTTGGTAGATATATAGG + Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972037269 4:34541213-34541235 TATTTTGTAGATAGTGATATAGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973092197 4:46150775-46150797 TTAAATTTTGATAGGTATATAGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973676267 4:53266764-53266786 TAAAACACTGACAGTGATATTGG + Intronic
973951832 4:56023057-56023079 TAAAATGTTTTTAGAGATAGGGG - Intronic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974784917 4:66607795-66607817 TGAGATGGTGATGGTGATATAGG - Intergenic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
975515347 4:75241459-75241481 TCATATGTTGATAGTCATTTGGG + Intergenic
975620503 4:76291538-76291560 AAAAAAGTAGATATTGATATTGG - Intronic
976236802 4:82905835-82905857 TAAAATGTGGATAATAATACAGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
978141915 4:105327562-105327584 TAAAATGTTGCTAGTGTTAATGG - Intergenic
978907336 4:114022344-114022366 TAAAATGGGAATGGTGATATGGG + Intergenic
978942415 4:114452579-114452601 TAAAATGTTCATACTGATCAAGG + Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979362811 4:119784286-119784308 CCAAATATTGATAGTGATGTGGG - Intergenic
979465514 4:121033023-121033045 TAAAATATTGGAAGAGATATTGG + Intergenic
979570063 4:122211955-122211977 TAAGTTGTTGAAAGTGATGTTGG - Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982894378 4:160899316-160899338 CCAAATGTTGATACTGGTATTGG + Intergenic
982916580 4:161217801-161217823 TAAAATATAGATTGTGATACAGG - Intergenic
983013244 4:162576610-162576632 AAAAATGTTGATAGTGGTAGAGG + Intergenic
983184476 4:164685789-164685811 TAAAGTGTTGAAAGTGTTAATGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983607115 4:169600083-169600105 GAAAATGTTAAAAGTGATATTGG - Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983769824 4:171535531-171535553 TAGAATGTTGGTAGAAATATGGG + Intergenic
983866842 4:172777456-172777478 TAAAATGTAAATTGAGATATTGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984213292 4:176877074-176877096 GAAAATGTTCTTAGTGAGATGGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985127555 4:186709993-186710015 AAGAATGTTGATACTTATATTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986120235 5:4828487-4828509 TATAATGTTTATAGTGATAGAGG - Intergenic
986382630 5:7202108-7202130 AAAAATGTTCAGAATGATATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987790002 5:22552733-22552755 TAAAATGTTAATAGAAAAATGGG - Intronic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
987926644 5:24350707-24350729 TAAATTGATGTTAGTGAGATGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988235829 5:28542786-28542808 GAACAAGTTGATAATGATATAGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988572615 5:32385167-32385189 TAAAATGTTGCTAGTGACTAGGG - Intronic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990080465 5:51906651-51906673 GAAAATTTTCATAGTAATATGGG + Intergenic
990430918 5:55734785-55734807 TAGAATGTTGCTTGAGATATGGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991150778 5:63366193-63366215 TAAAATCTTGAAAGTAATAGAGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991437045 5:66607559-66607581 TAACATGTTAACAGTAATATTGG + Intronic
991734371 5:69618238-69618260 ATAAATGTTCATTGTGATATAGG + Intergenic
991780608 5:70128487-70128509 ATAAATGTTCATTGTGATATAGG - Intergenic
991810804 5:70473373-70473395 ATAAATGTTCATTGTGATATAGG + Intergenic
991859896 5:71003910-71003932 ATAAATGTTCATTGTGATATAGG - Intronic
991873056 5:71128806-71128828 ATAAATGTTCATTGTGATATAGG - Intergenic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993226430 5:85170912-85170934 GAAAATGTTGGTAGTCATAAAGG + Intergenic
993633033 5:90310725-90310747 TAAGATGTTGATTGTGTAATGGG + Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
994940492 5:106317336-106317358 TATTCTGTTGATAGTTATATTGG + Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995371434 5:111423455-111423477 TAACATGTTGAACGTGCTATAGG + Intronic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996191086 5:120542411-120542433 GAAAATGTTAATAGTGATAGAGG - Intronic
996282187 5:121743377-121743399 TGAAATCTTGAAAGTCATATCGG + Intergenic
996347989 5:122508290-122508312 TAAAATGGAGATAATGATAATGG - Intergenic
996603329 5:125291948-125291970 TAAAATGTTCATTGTTCTATAGG - Intergenic
997111461 5:131079519-131079541 TAAAGTGTTCCTGGTGATATTGG - Intergenic
999168662 5:149573926-149573948 TATCCTGTTGATAGTTATATGGG + Intronic
999448646 5:151661778-151661800 TGAAATGTTGCTAGTGTGATTGG + Exonic
999715576 5:154357376-154357398 CAAAATGTTAATAGTGGTCTGGG + Intronic
999842060 5:155438371-155438393 TTAAGTGTTGATACTGGTATTGG + Intergenic
1000077221 5:157802265-157802287 TAAAATGTAGACAGTAAGATGGG - Intronic
1000183757 5:158839002-158839024 TAAAATGTTAATAGAGGTCTGGG - Intronic
1000262771 5:159604090-159604112 TTTAATGTTGATAGGGATATAGG - Intergenic
1000582868 5:163055337-163055359 TAAACTGTTGATAGGTATTTGGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1000788141 5:165571317-165571339 GAAAATGTTGATAATGATGTGGG - Intergenic
1001527965 5:172442064-172442086 TTAAATGTTGTTAGTGATTACGG - Intronic
1001891026 5:175338760-175338782 TAAAATGTATGTAGTGATAATGG - Intergenic
1002968824 6:1993341-1993363 TGTAATGTTGAAAGTGATAGAGG - Intronic
1003391272 6:5715129-5715151 TAACATGAGGATAGTAATATGGG - Intronic
1003768708 6:9272102-9272124 TAAAATGTTCATATTTATAAGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1003884337 6:10507530-10507552 TAAAATATTGATAGTGCCAAGGG + Intronic
1004332439 6:14734221-14734243 TAACTTGTTGATAGAGATAGTGG - Intergenic
1004884151 6:20035936-20035958 TAAAATGTTGATTCTGATTCGGG + Intergenic
1005160252 6:22851410-22851432 TAAAAAGTTAATAGTGAAATTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007545298 6:42688888-42688910 AAGAATTTAGATAGTGATATAGG + Intronic
1008200359 6:48580259-48580281 TAAAATATTATTAGTGATCTGGG + Intergenic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1008838452 6:55867415-55867437 TATAATGTTTATAGTGTTGTGGG - Intronic
1008952966 6:57181080-57181102 CAGAATGTTGGTAGGGATATGGG + Intronic
1009405393 6:63306099-63306121 TAAAATGTTAATATTTTTATAGG - Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010419569 6:75656692-75656714 TAAATGATTGATAGTGTTATAGG - Intronic
1010420548 6:75669787-75669809 TAAAATGCTGCTAGTTATAGTGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010713966 6:79207029-79207051 TAAAATGGGGATACAGATATTGG - Intronic
1010769235 6:79809697-79809719 TAAAATTTTGATAGGCATAGAGG - Intergenic
1010875158 6:81094741-81094763 TTATATGCTGATAGTTATATTGG + Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1011789027 6:90878234-90878256 TTAGATGCTGATAGTGATACTGG - Intergenic
1011819454 6:91234356-91234378 TAAAATGCAGATGATGATATTGG - Intergenic
1011895451 6:92218830-92218852 TAAAATGTAGCTAGTGATACAGG - Intergenic
1012056063 6:94411955-94411977 TAAATTGTTGCTATTGACATTGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012321033 6:97846078-97846100 TAAAATGGTGCAAGTGAAATGGG - Intergenic
1012344390 6:98168874-98168896 TAAATTGTTGGTAGTGTAATGGG - Intergenic
1012379296 6:98600904-98600926 TATAATGATGACAGTGATAAGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012646090 6:101683845-101683867 TAAAATTTTGTTGGTGATACAGG - Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013112925 6:107078806-107078828 TAGCATGCTGGTAGTGATATGGG + Intronic
1013490710 6:110643903-110643925 TTAAATTTTAATAGTGAGATGGG - Intronic
1013564520 6:111344114-111344136 TGAAAAGTTTAAAGTGATATTGG - Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014605422 6:123467984-123468006 TAAAATGTGGATAGTTGTAGGGG + Intronic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015910425 6:138163158-138163180 TAAAATTTTGAGAGTGGTTTAGG + Intronic
1016582393 6:145643942-145643964 TAAGATGTAGATAGTGACGTAGG + Intronic
1017679881 6:156852973-156852995 TATAATGCTGATAGGGATAATGG + Intronic
1018186315 6:161267876-161267898 TAAAATGTTAAAAGTGAGACTGG - Intronic
1018376060 6:163213976-163213998 TAGAATTTAGATTGTGATATAGG - Intronic
1018965248 6:168480400-168480422 GAAAATGTTAATAAAGATATAGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020843130 7:13246538-13246560 TAAAATGCTACTAGTGATACTGG - Intergenic
1020921181 7:14266514-14266536 AAAAATGTTTATAGTTATAAAGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1023514610 7:40988555-40988577 TAAAATGTGGATACTGATACTGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1027337444 7:77167893-77167915 AAGAATTTTGATAATGATATTGG - Intronic
1027789534 7:82621190-82621212 TACAATGGTGATACAGATATAGG - Intergenic
1028298972 7:89172405-89172427 AAAAATGTTGAGAGTGATTGTGG + Intronic
1028437526 7:90821672-90821694 TGAAATGTTGACAGTGATTGTGG - Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1029778298 7:102702905-102702927 AAGAATTTTGATAATGATATTGG + Intergenic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1031094077 7:117398286-117398308 TATAATTGTGATAGTGTTATGGG - Intronic
1031202517 7:118706260-118706282 TAAAATGCTGTCAGTGTTATTGG + Intergenic
1031241999 7:119257794-119257816 AAAAATGTTGGTATTGTTATGGG + Intergenic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031504014 7:122558704-122558726 AGAAATGTTTAGAGTGATATGGG + Intronic
1031761849 7:125723070-125723092 TAAAATGTTCATATTGATGATGG - Intergenic
1031779318 7:125941702-125941724 TAAATTGTTGATAGTGTAATAGG + Intergenic
1033669139 7:143473141-143473163 AAAATTGTTGATAGTTTTATGGG - Intergenic
1033918447 7:146357579-146357601 TCAAATGTTAATACGGATATAGG + Intronic
1033980612 7:147160448-147160470 TAAAATCTTGACAGTGACAGAGG - Intronic
1034079736 7:148265445-148265467 TAAAATTTTTATAGAGATAATGG + Intronic
1034279205 7:149839908-149839930 TAAAATATTGGGATTGATATTGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035323351 7:158048852-158048874 TGTGATGGTGATAGTGATATTGG - Intronic
1035596806 8:864830-864852 TAAAATATTAATATTTATATTGG + Intergenic
1036176587 8:6544203-6544225 TCAAATGTTGATAGTGAAGCTGG + Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037092589 8:14941188-14941210 CAAAATGTAGAAAGTTATATTGG - Intronic
1038654777 8:29439208-29439230 TAAAATTTTGATAGCCAAATAGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1038971164 8:32637217-32637239 TAAAAAGTTGATAGATAAATGGG - Intronic
1039166437 8:34686574-34686596 TTAAATGTTGAAAGAAATATGGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1042098880 8:65251041-65251063 TAAAAAGTTGATTGTGAGACCGG - Intergenic
1042403973 8:68382312-68382334 TACAATCTTGACAGTGTTATAGG + Intronic
1042740926 8:72045467-72045489 TAAAATGTGGCTAGTGTTACTGG + Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044252393 8:90019248-90019270 TAAAATATTGATACTGATGTAGG + Intronic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044487356 8:92768590-92768612 TAAATTGTTGATAGTGTAGTGGG + Intergenic
1044868934 8:96599466-96599488 TAAAATGTTGATAGATAATTAGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046292008 8:112174839-112174861 TAAAATGTTGATAATAAGAGAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047363782 8:124193690-124193712 TAAATTGATTATAGTGAAATTGG - Intergenic
1047531235 8:125678677-125678699 TGAAATTTTGTTATTGATATAGG + Intergenic
1047894564 8:129352301-129352323 TAATATGATGATACTGATAATGG + Intergenic
1048655191 8:136528347-136528369 TAAAATGTTGATAGTGGAAGAGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1048901194 8:139039528-139039550 TAAAATGTTGATGTTGACCTGGG + Intergenic
1050364967 9:4865372-4865394 TAAAATATTGAGAATAATATAGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050895025 9:10875987-10876009 AAAAATGGTGACAGTGATAAAGG + Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051558956 9:18418605-18418627 TAAAATGGGGAAAATGATATAGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052803637 9:32992896-32992918 TCAAATGATGATGGTGTTATGGG + Intronic
1053086586 9:35229069-35229091 TCAAATGTTGATAAGGATTTGGG - Intronic
1053328625 9:37182140-37182162 GAAAATGTTGACAGGGAAATAGG + Intronic
1053641494 9:40086194-40086216 TAAAATGATAATACTAATATTGG - Intergenic
1053729543 9:41039342-41039364 TAAAATGTGGATAATAATAGTGG - Intergenic
1053764642 9:41379280-41379302 TAAAATGATAATACTAATATTGG + Intergenic
1054322373 9:63683445-63683467 TAAAATGATAATACTAATATTGG - Intergenic
1054543257 9:66290437-66290459 TAAAATGATAATACTAATATTGG + Intergenic
1054698964 9:68392720-68392742 TAAAATGTGGATAATAATAGTGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055237056 9:74134598-74134620 TAACCTAGTGATAGTGATATCGG - Intergenic
1056336858 9:85579679-85579701 TTAAATTGTGATACTGATATAGG + Intronic
1056838450 9:89977539-89977561 TAAAAAATTGACAGTGATTTTGG + Intergenic
1056984855 9:91353483-91353505 TAAGATGTTTATACTAATATAGG + Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1058791694 9:108453013-108453035 TGAAATGTTGATAGTTATGGAGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059859679 9:118445576-118445598 TAAAATTTTGATAGTCATTGTGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1202789267 9_KI270719v1_random:69272-69294 TAAAATGATAATACTAATATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186604253 X:11073057-11073079 TAAAATGTTCATACTTTTATAGG + Intergenic
1186616505 X:11194003-11194025 TAGGATGATGATATTGATATTGG - Intronic
1187141113 X:16594473-16594495 TAAGATGTTGCTATTGATAGGGG + Intronic
1187772242 X:22712990-22713012 TAATCTGTTGATAGAAATATGGG - Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191965584 X:66753563-66753585 TATAATGTTGATCGTGATGATGG - Intergenic
1191977408 X:66888729-66888751 TAAAAAGTTGATAATGGAATGGG + Intergenic
1192207195 X:69104352-69104374 TAAAATGGTGATGATGATAATGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193143068 X:78049606-78049628 TAAAATGTTGATACTAAACTAGG - Exonic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193450933 X:81664714-81664736 TCAAATGTTGATAGACATTTGGG + Intergenic
1193493025 X:82173051-82173073 TAGAGTGTTGATGGTGATGTTGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194093148 X:89602742-89602764 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1194190546 X:90831055-90831077 TAAAATGTAGATGGTGATACTGG + Intergenic
1194270731 X:91811427-91811449 TAAAATGTTAACAGTGAGATTGG + Intronic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194535262 X:95098170-95098192 GAAAATATTGATATTGATCTTGG + Intergenic
1197084392 X:122454964-122454986 TAAATTGTTGGTAGTGAAGTGGG + Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197531294 X:127630255-127630277 TAAAATGTTCTTGATGATATTGG + Intergenic
1197567973 X:128112086-128112108 TTAACTGTTGATAGTCATTTAGG - Intergenic
1198547627 X:137709710-137709732 TAAAAGTGTGTTAGTGATATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1198993438 X:142544346-142544368 TAAAAGGATGACAGTCATATTGG - Intergenic
1199210297 X:145200713-145200735 TAACATGTTGTTACAGATATAGG - Intergenic
1199413996 X:147558714-147558736 TAAAATGCTGATACTTATCTAGG + Intergenic
1199840513 X:151642787-151642809 TAAAATGTTAATAGAAAAATTGG - Intronic
1199849928 X:151718365-151718387 TATAATGTTGCAAATGATATTGG + Intronic
1199927542 X:152483777-152483799 TAAACTGTTGATGGGGATTTGGG - Intergenic
1200445779 Y:3258845-3258867 CAAAATGTTGATAGTGGGTTGGG + Intergenic
1200537206 Y:4413479-4413501 TAAAATGTAGATGGTGATACTGG + Intergenic
1200587964 Y:5032860-5032882 TAAAATGTTAACAGTGAGATTGG + Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic