ID: 981354662

View in Genome Browser
Species Human (GRCh38)
Location 4:143774440-143774462
Sequence AGCCTGGAGAGCCTGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354662_981354675 19 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354675 4:143774482-143774504 ACAACCTTGGTGGGAGCTGAGGG No data
981354662_981354674 18 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354674 4:143774481-143774503 CACAACCTTGGTGGGAGCTGAGG No data
981354662_981354670 6 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354662_981354672 10 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354672 4:143774473-143774495 GGACCAAGCACAACCTTGGTGGG No data
981354662_981354671 9 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354671 4:143774472-143774494 GGGACCAAGCACAACCTTGGTGG No data
981354662_981354676 20 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354662 Original CRISPR AGCCTGGAGAGCCTGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr