ID: 981354663

View in Genome Browser
Species Human (GRCh38)
Location 4:143774444-143774466
Sequence AGTTAGCCTGGAGAGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354663_981354672 6 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354672 4:143774473-143774495 GGACCAAGCACAACCTTGGTGGG No data
981354663_981354670 2 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354663_981354671 5 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354671 4:143774472-143774494 GGGACCAAGCACAACCTTGGTGG No data
981354663_981354676 16 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG No data
981354663_981354674 14 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354674 4:143774481-143774503 CACAACCTTGGTGGGAGCTGAGG No data
981354663_981354678 27 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data
981354663_981354675 15 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354675 4:143774482-143774504 ACAACCTTGGTGGGAGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354663 Original CRISPR AGTTAGCCTGGAGAGCCTGG AGG (reversed) Intergenic