ID: 981354664

View in Genome Browser
Species Human (GRCh38)
Location 4:143774447-143774469
Sequence CCTAGTTAGCCTGGAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354664_981354674 11 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354674 4:143774481-143774503 CACAACCTTGGTGGGAGCTGAGG No data
981354664_981354671 2 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354671 4:143774472-143774494 GGGACCAAGCACAACCTTGGTGG No data
981354664_981354672 3 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354672 4:143774473-143774495 GGACCAAGCACAACCTTGGTGGG No data
981354664_981354675 12 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354675 4:143774482-143774504 ACAACCTTGGTGGGAGCTGAGGG No data
981354664_981354676 13 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG No data
981354664_981354670 -1 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354664_981354678 24 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354664 Original CRISPR CCTAGTTAGCCTGGAGAGCC TGG (reversed) Intergenic