ID: 981354669

View in Genome Browser
Species Human (GRCh38)
Location 4:143774456-143774478
Sequence TGGTCCCACCCTAGTTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354669_981354672 -6 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354672 4:143774473-143774495 GGACCAAGCACAACCTTGGTGGG No data
981354669_981354679 22 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354679 4:143774501-143774523 AGGGGCAGCTCTCAGGCCACTGG No data
981354669_981354671 -7 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354671 4:143774472-143774494 GGGACCAAGCACAACCTTGGTGG No data
981354669_981354675 3 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354675 4:143774482-143774504 ACAACCTTGGTGGGAGCTGAGGG No data
981354669_981354670 -10 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354669_981354676 4 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG No data
981354669_981354678 15 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data
981354669_981354674 2 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354674 4:143774481-143774503 CACAACCTTGGTGGGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354669 Original CRISPR TGGTCCCACCCTAGTTAGCC TGG (reversed) Intergenic
No off target data available for this crispr