ID: 981354670

View in Genome Browser
Species Human (GRCh38)
Location 4:143774469-143774491
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354669_981354670 -10 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354663_981354670 2 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354664_981354670 -1 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data
981354662_981354670 6 Left 981354662 4:143774440-143774462 CCTACCTCCAGGCTCTCCAGGCT No data
Right 981354670 4:143774469-143774491 GGTGGGACCAAGCACAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr