ID: 981354673

View in Genome Browser
Species Human (GRCh38)
Location 4:143774476-143774498
Sequence GCTCCCACCAAGGTTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354673_981354679 2 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354679 4:143774501-143774523 AGGGGCAGCTCTCAGGCCACTGG No data
981354673_981354684 18 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354684 4:143774517-143774539 CCACTGGAACAACCCAGGGAGGG No data
981354673_981354680 13 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354680 4:143774512-143774534 TCAGGCCACTGGAACAACCCAGG No data
981354673_981354685 19 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354685 4:143774518-143774540 CACTGGAACAACCCAGGGAGGGG No data
981354673_981354681 14 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354681 4:143774513-143774535 CAGGCCACTGGAACAACCCAGGG No data
981354673_981354686 25 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354686 4:143774524-143774546 AACAACCCAGGGAGGGGCAGAGG No data
981354673_981354682 17 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354682 4:143774516-143774538 GCCACTGGAACAACCCAGGGAGG No data
981354673_981354678 -5 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354673 Original CRISPR GCTCCCACCAAGGTTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr