ID: 981354678

View in Genome Browser
Species Human (GRCh38)
Location 4:143774494-143774516
Sequence GGAGCTGAGGGGCAGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354669_981354678 15 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data
981354673_981354678 -5 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data
981354664_981354678 24 Left 981354664 4:143774447-143774469 CCAGGCTCTCCAGGCTAACTAGG No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data
981354663_981354678 27 Left 981354663 4:143774444-143774466 CCTCCAGGCTCTCCAGGCTAACT No data
Right 981354678 4:143774494-143774516 GGAGCTGAGGGGCAGCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354678 Original CRISPR GGAGCTGAGGGGCAGCTCTC AGG Intergenic
No off target data available for this crispr