ID: 981354679

View in Genome Browser
Species Human (GRCh38)
Location 4:143774501-143774523
Sequence AGGGGCAGCTCTCAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354677_981354679 -8 Left 981354677 4:143774486-143774508 CCTTGGTGGGAGCTGAGGGGCAG No data
Right 981354679 4:143774501-143774523 AGGGGCAGCTCTCAGGCCACTGG No data
981354673_981354679 2 Left 981354673 4:143774476-143774498 CCAAGCACAACCTTGGTGGGAGC No data
Right 981354679 4:143774501-143774523 AGGGGCAGCTCTCAGGCCACTGG No data
981354669_981354679 22 Left 981354669 4:143774456-143774478 CCAGGCTAACTAGGGTGGGACCA No data
Right 981354679 4:143774501-143774523 AGGGGCAGCTCTCAGGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354679 Original CRISPR AGGGGCAGCTCTCAGGCCAC TGG Intergenic
No off target data available for this crispr