ID: 981354681 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:143774513-143774535 |
Sequence | CAGGCCACTGGAACAACCCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
981354677_981354681 | 4 | Left | 981354677 | 4:143774486-143774508 | CCTTGGTGGGAGCTGAGGGGCAG | 0: 1 1: 0 2: 8 3: 53 4: 483 |
||
Right | 981354681 | 4:143774513-143774535 | CAGGCCACTGGAACAACCCAGGG | No data | ||||
981354673_981354681 | 14 | Left | 981354673 | 4:143774476-143774498 | CCAAGCACAACCTTGGTGGGAGC | No data | ||
Right | 981354681 | 4:143774513-143774535 | CAGGCCACTGGAACAACCCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
981354681 | Original CRISPR | CAGGCCACTGGAACAACCCA GGG | Intergenic | ||