ID: 981354684 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:143774517-143774539 |
| Sequence | CCACTGGAACAACCCAGGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 981354677_981354684 | 8 | Left | 981354677 | 4:143774486-143774508 | CCTTGGTGGGAGCTGAGGGGCAG | 0: 1 1: 0 2: 8 3: 53 4: 483 |
||
| Right | 981354684 | 4:143774517-143774539 | CCACTGGAACAACCCAGGGAGGG | No data | ||||
| 981354673_981354684 | 18 | Left | 981354673 | 4:143774476-143774498 | CCAAGCACAACCTTGGTGGGAGC | No data | ||
| Right | 981354684 | 4:143774517-143774539 | CCACTGGAACAACCCAGGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 981354684 | Original CRISPR | CCACTGGAACAACCCAGGGA GGG | Intergenic | ||