ID: 981354962

View in Genome Browser
Species Human (GRCh38)
Location 4:143778284-143778306
Sequence CCCGTAGGGTACCCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354962_981354968 -8 Left 981354962 4:143778284-143778306 CCAGACTTTGGGTACCCTACGGG No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354962 Original CRISPR CCCGTAGGGTACCCAAAGTC TGG (reversed) Intergenic