ID: 981354968

View in Genome Browser
Species Human (GRCh38)
Location 4:143778299-143778321
Sequence CCTACGGGTGGTGTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981354957_981354968 4 Left 981354957 4:143778272-143778294 CCTTTGTCACCACCAGACTTTGG No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354953_981354968 28 Left 981354953 4:143778248-143778270 CCTCTTAACTTGTCTCCCCTCAA No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354955_981354968 12 Left 981354955 4:143778264-143778286 CCCTCAATCCTTTGTCACCACCA No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354960_981354968 -5 Left 981354960 4:143778281-143778303 CCACCAGACTTTGGGTACCCTAC No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354962_981354968 -8 Left 981354962 4:143778284-143778306 CCAGACTTTGGGTACCCTACGGG No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354956_981354968 11 Left 981354956 4:143778265-143778287 CCTCAATCCTTTGTCACCACCAG No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data
981354954_981354968 13 Left 981354954 4:143778263-143778285 CCCCTCAATCCTTTGTCACCACC No data
Right 981354968 4:143778299-143778321 CCTACGGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981354968 Original CRISPR CCTACGGGTGGTGTTGAGGC TGG Intergenic