ID: 981361325

View in Genome Browser
Species Human (GRCh38)
Location 4:143848893-143848915
Sequence GTACACTCATTGGTAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981361325_981361329 -8 Left 981361325 4:143848893-143848915 CCCTTATTTACCAATGAGTGTAC No data
Right 981361329 4:143848908-143848930 GAGTGTACTGAGGTACAGAGAGG No data
981361325_981361330 11 Left 981361325 4:143848893-143848915 CCCTTATTTACCAATGAGTGTAC No data
Right 981361330 4:143848927-143848949 GAGGTTAACATAATTAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981361325 Original CRISPR GTACACTCATTGGTAAATAA GGG (reversed) Intergenic
No off target data available for this crispr