ID: 981361801

View in Genome Browser
Species Human (GRCh38)
Location 4:143854684-143854706
Sequence AAGTTCCCCTTTAAAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981361801_981361811 13 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361811 4:143854720-143854742 GGCAGGGAAGGAGCAGTTGGGGG No data
981361801_981361804 -8 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361804 4:143854699-143854721 GGGAACTTGGCGTGAATGGCAGG No data
981361801_981361810 12 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361810 4:143854719-143854741 AGGCAGGGAAGGAGCAGTTGGGG No data
981361801_981361808 10 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361808 4:143854717-143854739 GCAGGCAGGGAAGGAGCAGTTGG No data
981361801_981361806 -3 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361806 4:143854704-143854726 CTTGGCGTGAATGGCAGGCAGGG No data
981361801_981361812 19 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361812 4:143854726-143854748 GAAGGAGCAGTTGGGGGTCTAGG No data
981361801_981361809 11 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361809 4:143854718-143854740 CAGGCAGGGAAGGAGCAGTTGGG No data
981361801_981361807 1 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361807 4:143854708-143854730 GCGTGAATGGCAGGCAGGGAAGG No data
981361801_981361805 -4 Left 981361801 4:143854684-143854706 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981361805 4:143854703-143854725 ACTTGGCGTGAATGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981361801 Original CRISPR AAGTTCCCCTTTAAAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr