ID: 981362075

View in Genome Browser
Species Human (GRCh38)
Location 4:143858548-143858570
Sequence TAGGACTTCTTGGGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981362070_981362075 9 Left 981362070 4:143858516-143858538 CCTTCAGGCAGATATAATAGGAT No data
Right 981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981362075 Original CRISPR TAGGACTTCTTGGGTAAAAA AGG Intergenic
No off target data available for this crispr