ID: 981364752

View in Genome Browser
Species Human (GRCh38)
Location 4:143889412-143889434
Sequence TGGCTTTGCCACCAAATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 1, 2: 0, 3: 15, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981364747_981364752 9 Left 981364747 4:143889380-143889402 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG 0: 2
1: 1
2: 0
3: 15
4: 175
981364746_981364752 16 Left 981364746 4:143889373-143889395 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG 0: 2
1: 1
2: 0
3: 15
4: 175
981364748_981364752 8 Left 981364748 4:143889381-143889403 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG 0: 2
1: 1
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981364752 Original CRISPR TGGCTTTGCCACCAAATGGT TGG Intronic
902124680 1:14198884-14198906 TAGCTTTGCCACCTACTGGCTGG - Intergenic
902581078 1:17408039-17408061 TGGCTCTGGTACCAAATAGTTGG - Exonic
903181353 1:21606437-21606459 TGGCTCTGCCACCAACTTGCCGG + Intronic
905342661 1:37289952-37289974 TGACTCTGCCACTGAATGGTTGG - Intergenic
905466579 1:38158859-38158881 GGCAGTTGCCACCAAATGGTTGG - Intergenic
905989897 1:42327416-42327438 TGGCTTGGCCATCAAATTTTGGG - Intronic
906352815 1:45078710-45078732 TGGCTTTGCCACCTGCTGATTGG - Intronic
907191139 1:52649999-52650021 AGGCTTGGCCACCAATTGGCTGG - Intronic
908525449 1:64983593-64983615 TGGCTCTACCACCAGATGGGTGG + Intergenic
909746601 1:79105408-79105430 TGGTTTGGGGACCAAATGGTAGG - Intergenic
915534386 1:156526218-156526240 TGGCTTTCCTGCCAGATGGTAGG - Exonic
916344519 1:163772822-163772844 TGGCTCTGCAATCAAATGGTAGG + Intergenic
918826915 1:189336505-189336527 TTGCTTTGCCATCACATGGATGG + Intergenic
921120518 1:212132390-212132412 TCAATTTGCCACCAAATGATTGG - Intergenic
921265822 1:213419885-213419907 TGGCTTTGCCACCCTGTGGGAGG + Intergenic
921328417 1:214011010-214011032 TGGCCTTCCCACAAAATGGGAGG - Intronic
922902066 1:229144901-229144923 TCCATTTGCCACCAAGTGGTTGG - Intergenic
923025352 1:230199449-230199471 TGGCTTCACCACCTAATGATGGG - Intronic
1062782768 10:231171-231193 AGGCTTTGCGACCATGTGGTTGG - Intronic
1063330799 10:5157421-5157443 TGGCTTTGCCACTTACTAGTTGG - Intergenic
1064869754 10:19924262-19924284 AGGTTTTGGCACCAAATGTTAGG - Intronic
1065281514 10:24143590-24143612 TAGCTTAGCCCCAAAATGGTGGG - Intronic
1067382673 10:45789263-45789285 TTGCTTTACCACCCACTGGTGGG - Exonic
1067890375 10:50129811-50129833 TTGCTTTACCACCCACTGGTGGG - Exonic
1068237398 10:54256069-54256091 TGGCATGGCCACCAAATAGCTGG - Intronic
1068748602 10:60565117-60565139 TGGCCTTTCTACCAAATAGTTGG + Intronic
1068794447 10:61063117-61063139 TGTCATTGCCACCAAATCCTGGG - Intergenic
1070833291 10:79433171-79433193 GGGCTCTGCCACTAACTGGTGGG + Intronic
1075101782 10:119511201-119511223 TGGCTTTGCCTCCAAAGGGCTGG + Intronic
1076000347 10:126907958-126907980 TGGTTTTGCCAGGAAATGCTAGG + Intronic
1079388770 11:20003014-20003036 TGGCTGTTCCACCAACTGGGAGG + Intronic
1079528499 11:21419676-21419698 TGGCTTTTCTCTCAAATGGTTGG - Intronic
1083028383 11:59570106-59570128 TGGCTTTCCCATAAAATGGAGGG - Intergenic
1083643204 11:64156756-64156778 TGGCTCTGCCACCAGCTGGCTGG + Intronic
1084741264 11:71140905-71140927 TGGGTGTGCCACCAACTGCTTGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1087229725 11:95646840-95646862 TGTCTTGCCCACAAAATGGTTGG + Intergenic
1088965112 11:114712240-114712262 TGGCTATGACACCAAATGCAAGG + Intergenic
1088983327 11:114883590-114883612 TAGCTTTGCCAGCAAAAGGTAGG - Intergenic
1091581634 12:1793905-1793927 TTGCTTTTCCCCCAAAAGGTAGG - Intronic
1091686039 12:2563422-2563444 TGGATTTTCCCCCAAGTGGTAGG + Intronic
1094004323 12:25731275-25731297 TGGCTTTTCCATCAACTGATAGG - Intergenic
1096495953 12:52039518-52039540 TGGATCTGCCGCCAAATGGAAGG + Intronic
1096878459 12:54648321-54648343 TGGGTATGCCACCAAATCCTTGG + Exonic
1103287848 12:119817577-119817599 TTGCTGTACCTCCAAATGGTGGG - Intronic
1104411877 12:128565056-128565078 AGGCTTTGCCACCTAATCATGGG - Intronic
1106171481 13:27292381-27292403 TGCCTTTGCCAATAAATGTTGGG - Intergenic
1113956567 13:114102669-114102691 TGGCTGTGACACCACCTGGTGGG - Intronic
1114067384 14:19073767-19073789 TGGGTTTGCTATCAAATAGTAGG + Intergenic
1114094875 14:19326260-19326282 TGGGTTTGCTATCAAATAGTAGG - Intergenic
1117013854 14:51498346-51498368 TGGCTTTGGGACCACATGGTGGG - Intronic
1117283565 14:54264493-54264515 TTTCTTTGCCACCTAATTGTGGG - Intergenic
1117322947 14:54641644-54641666 TGGGTTTGCCTCTTAATGGTGGG - Intronic
1118254364 14:64192485-64192507 TCTCTTTCCCACCAAAAGGTTGG - Intronic
1119607162 14:76029745-76029767 TGACTTTGCCACAGATTGGTTGG + Intronic
1122258505 14:100498598-100498620 TGGCTGGGCCACCAACTGGGTGG - Intronic
1123510229 15:20991450-20991472 TGCGTTGGCCACCAAGTGGTAGG + Intergenic
1123567445 15:21565203-21565225 TGCGTTGGCCACCAAGTGGTAGG + Intergenic
1123603709 15:22002496-22002518 TGCGTTGGCCACCAAGTGGTAGG + Intergenic
1202975809 15_KI270727v1_random:292297-292319 TGCGTTGGCCACCAAGTGGTAGG + Intergenic
1140144002 16:72287700-72287722 TGGCATAGCCACCATATGGCTGG - Intergenic
1143388846 17:6548258-6548280 GTGCTTTGGCACCAAATGGAGGG - Intronic
1143675988 17:8433195-8433217 TGGTTTTGCCACCCATTGGGTGG + Intronic
1144145727 17:12396170-12396192 TGGCTATGGCAACAAATAGTTGG + Intergenic
1144361419 17:14498006-14498028 TGGCTTCATCACCATATGGTGGG - Intergenic
1144637295 17:16918375-16918397 TGGCTTTGCCACAGTAGGGTGGG + Intergenic
1144739266 17:17572132-17572154 TGGCTTGGCCAGCCCATGGTTGG - Intronic
1147706784 17:42431013-42431035 TGCCTTTGCCTCCAAACTGTTGG + Intergenic
1150770468 17:68036238-68036260 TGGCTCTGCCACCAAGTCGTAGG + Exonic
1150855605 17:68749512-68749534 TAGCTGTGCCACCAACTGGAAGG - Intergenic
1151102653 17:71573519-71573541 TGGCTCTGCCACAGAATGTTGGG + Intergenic
1151768505 17:76144651-76144673 TGGCTCTGCCACCAGAAGGAAGG + Exonic
1153279135 18:3397848-3397870 TGCTTCTGCCAGCAAATGGTGGG - Intergenic
1157133933 18:45035802-45035824 TGGCATTCCCACCGAATGGATGG - Intronic
1157844308 18:50988755-50988777 TGCCTTGGCCTCCAAATGCTGGG - Intronic
1157937634 18:51890946-51890968 TGACTATGCCACTAAATGGTTGG + Intergenic
1158240905 18:55376996-55377018 TGGCTGAGGCACTAAATGGTGGG + Intronic
1163088543 19:15001629-15001651 TGGCTTTACAACCAATAGGTGGG - Intronic
1163127573 19:15252563-15252585 TGGCTTTGCCACCCGAAGCTAGG - Intronic
1165155462 19:33784485-33784507 TGGGCTTGCCACCAAGTGATAGG - Intergenic
1165234365 19:34408669-34408691 TGTCTTTGCCACCGAACCGTTGG + Intronic
929684373 2:44021588-44021610 TGGGTTTGACACCACAGGGTGGG + Intergenic
929932701 2:46271266-46271288 AGGCCTTGACACCAAATGGCAGG - Intergenic
930239631 2:48922622-48922644 TGGCTTTGGCACCACATAATGGG - Intergenic
932108840 2:68974709-68974731 TGAATTTACCACCAAATGATTGG + Intronic
932672640 2:73751913-73751935 TGTCTTCCCCACCTAATGGTGGG - Intergenic
935670954 2:105556813-105556835 TTCCTTTGGCCCCAAATGGTTGG - Intergenic
937000090 2:118457853-118457875 TGTCTGTCCCACTAAATGGTGGG - Intergenic
940109047 2:150130417-150130439 TGGATTTGCTTCCAAATGTTTGG + Intergenic
941279869 2:163536577-163536599 TGGCTTTGACACCATTTGTTGGG + Intergenic
944864428 2:203846857-203846879 TGGCTTTTCCACCAAATAGCAGG + Intergenic
945810249 2:214541108-214541130 TAACTTTGGCACAAAATGGTAGG + Intronic
946598546 2:221333561-221333583 TTGCCTTGCTACCAAATGTTGGG + Intergenic
946781433 2:223195796-223195818 TGGCTGTGCCACCTCCTGGTTGG - Intronic
947659912 2:231858936-231858958 TTACTTTACCACCAAATGGATGG + Intergenic
948052079 2:234986261-234986283 TGGCTCTGCCACTAAATGCTGGG - Intronic
948370542 2:237486795-237486817 TGGCGTTGCCACTTACTGGTCGG + Intronic
948526291 2:238572903-238572925 TGGCTATGCCACCTAATAGCTGG + Intergenic
1168949416 20:1786404-1786426 TGGCTCTGCCACCAATTTGCAGG + Intergenic
1169594275 20:7180168-7180190 TTGCTTTGTCACCAATTGTTGGG + Intergenic
1177921123 21:27153866-27153888 TGGCTTTGAAACCAAGTGGATGG + Intergenic
1180485860 22:15796335-15796357 TGGGTTTGCTATCAAATAGTAGG + Intergenic
1182794597 22:32981886-32981908 TGGTTTTGCCTTCAAAGGGTAGG - Intronic
949124148 3:425271-425293 AGGCCTTGCAACCAGATGGTTGG + Intergenic
949869234 3:8573482-8573504 AGGCTTTGGCTCCAAATGTTTGG + Intergenic
950948247 3:16973249-16973271 TGGCTCTGCCACGAAATTATTGG + Intronic
951088457 3:18542719-18542741 TGGAGTTTCCAGCAAATGGTTGG + Intergenic
952557287 3:34547216-34547238 TGTCTTCACCACCAAATAGTTGG - Intergenic
954009934 3:47627166-47627188 TGGCTTTGGGACCACATAGTGGG + Intronic
956209058 3:66784670-66784692 TGGCTTTGGGACCAAGTAGTGGG - Intergenic
956273998 3:67478064-67478086 TGGCTCTGCCACTAACTGCTTGG - Intronic
958636715 3:96754831-96754853 TGGCTCTGGTACCAAATAGTTGG + Intergenic
962425188 3:135263245-135263267 TGGCTCTGGCACCAACTGGCTGG + Intergenic
963228643 3:142888547-142888569 TGGCTTGGCCACCACGTGGCGGG - Intronic
963688926 3:148473799-148473821 TGGCTTTCTCTTCAAATGGTGGG + Intergenic
963850600 3:150206882-150206904 TGGCTTTGCCTCCAAAAGCAGGG + Intergenic
964765737 3:160177264-160177286 TGGCTTTTCCTACAAAGGGTTGG - Intergenic
967101173 3:186216909-186216931 TGGCTTTGCCACTCACTGGCTGG + Intronic
970369945 4:15396311-15396333 TGGCTGTGCCTTCAAATGGGAGG + Intronic
970573126 4:17402251-17402273 TGTATGTGCCACCTAATGGTGGG + Intergenic
970665816 4:18334908-18334930 TTTCTTTTCTACCAAATGGTTGG - Intergenic
971961160 4:33488652-33488674 TGGCTTTGCCTGCTATTGGTAGG + Intergenic
972708558 4:41570633-41570655 TTTCTTTGCCACAAAATGTTCGG - Intronic
976602966 4:86955694-86955716 AGGCTATACCACCAAATGGGTGG + Intronic
978446720 4:108787387-108787409 TGGCTCTGGTACCAAATAGTTGG - Intergenic
979029560 4:115624700-115624722 CGTCTTTGAAACCAAATGGTTGG + Intergenic
981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG + Intronic
981375252 4:144007683-144007705 TGGCTTTGCCATCAAATGGTTGG + Intronic
981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG + Intronic
982194344 4:152895193-152895215 TGGCTTAGACAAGAAATGGTAGG + Intronic
987208211 5:15649853-15649875 TTACTTTGACACCAAATGGCTGG + Intronic
988942271 5:36158545-36158567 TGGGTTCACCACCAAATGGAAGG - Intronic
988989465 5:36655365-36655387 TGGCTTTGTCACTAATTGTTAGG + Intronic
990098875 5:52157047-52157069 TGGCTTTGCCACAATGTGGTGGG - Intergenic
992414884 5:76542826-76542848 TGTCATTGCCACCTAATTGTAGG + Intronic
993774247 5:91971133-91971155 TGGGATTGTCCCCAAATGGTAGG + Intergenic
995257063 5:110059027-110059049 TGGCTTTGCCACTAGCTGGGAGG + Intergenic
998988128 5:147784539-147784561 AGGCTTTCCCACCAAGTGGATGG - Intergenic
1001367825 5:171162101-171162123 TGGCTATGGCACCAGATGCTTGG - Intronic
1001480951 5:172088973-172088995 TGGTTTTGCCTCCAAAATGTAGG + Intronic
1006692226 6:35898910-35898932 TGTCTTGGCCACCAAGTGCTGGG - Intronic
1007704049 6:43780485-43780507 TGGGTTTGCCATCCCATGGTGGG + Intronic
1011735802 6:90309647-90309669 TGCCTCTGCCAGCAAATGTTTGG + Intergenic
1013375022 6:109506402-109506424 TGGATTTCACAGCAAATGGTGGG - Exonic
1013617221 6:111855537-111855559 TGGCTTTGTCACAAAAAGTTTGG - Intronic
1016450106 6:144173860-144173882 TGGCTTTGGCACCAGATAGCAGG - Intronic
1017767608 6:157619535-157619557 TGGCCTTGCCACCACCTGGCAGG - Intronic
1017942184 6:159062708-159062730 GGGCTTTGGCAGGAAATGGTTGG - Intergenic
1023309380 7:38868247-38868269 TGGCATTGCAGCCAAATGGCTGG + Intronic
1023362082 7:39427308-39427330 AGGCTTTGCCACCAACTAGTAGG - Intronic
1023806081 7:43874030-43874052 TGGCTTTTCCACCACAGGGCAGG + Intronic
1024793603 7:52995456-52995478 TGGTTTTGCCACAAAAGGGCTGG + Intergenic
1026146831 7:67753846-67753868 AGGTTTTGGCACCAAATGTTAGG + Intergenic
1026583034 7:71633769-71633791 TGGATTTGCCAGCAGCTGGTAGG - Intronic
1027621707 7:80495036-80495058 TGTCTTTGCCAGCAAATGGATGG - Intronic
1028440353 7:90852550-90852572 AGTCTTTGCCACCATATGGTTGG + Intronic
1029902452 7:104056032-104056054 TGGCTTTGGGACCAAATGATTGG - Intergenic
1030804007 7:113890987-113891009 TGGATTTGCCACTAGTTGGTTGG - Intronic
1031352318 7:120749582-120749604 TGGCTTTACTAGAAAATGGTTGG - Exonic
1033173647 7:139106022-139106044 TGGCTCTGCCAATAAATGTTAGG + Intronic
1033825194 7:145180882-145180904 TGTAACTGCCACCAAATGGTTGG - Intergenic
1034604112 7:152294975-152294997 TGGCTTTGACACTAAATGTCAGG - Intronic
1035384427 7:158460812-158460834 AGGCTTTGCCAGCCAAAGGTGGG - Intronic
1035551933 8:535284-535306 TGGCTTTGTCTAGAAATGGTTGG - Intronic
1037507974 8:19551447-19551469 TGACTTTGCCACCCAATTGAGGG - Intronic
1037836026 8:22215183-22215205 TCACGTAGCCACCAAATGGTGGG - Intergenic
1042725541 8:71871358-71871380 TGGCTTTGTCAAAAATTGGTTGG + Intronic
1042960968 8:74303383-74303405 TGGCTTAGCCAACTAATGGATGG - Intronic
1049059294 8:140263720-140263742 TGGCTTTGCCACCTACTGGCTGG - Intronic
1055303601 9:74906110-74906132 TGGCTTTGCAAGCTAAGGGTGGG - Intergenic
1056559355 9:87716749-87716771 TAGCTGTGCCAACAAATAGTGGG - Intergenic
1056816128 9:89802530-89802552 TGGCTCTGCCTCTGAATGGTGGG + Intergenic
1057404872 9:94760358-94760380 TGACTTTGCCTGCAAATCGTTGG + Exonic
1057448005 9:95132159-95132181 GGGCTCTGCCAGCAAATGGGAGG + Intronic
1058966540 9:110044233-110044255 GGGCTTTCCCACCAAACAGTGGG - Intronic
1059069835 9:111123888-111123910 TGCCTTAGCCTCCCAATGGTAGG - Intergenic
1059597604 9:115739621-115739643 TGGCTTTTCCAGCACATGCTTGG - Intergenic
1059695185 9:116723896-116723918 TGGCTTTGCCGCAAACTTGTGGG - Intronic
1059917510 9:119119815-119119837 TGCCTTTTGCATCAAATGGTTGG + Intergenic
1061334714 9:129924995-129925017 TGGATTTGCCACCAAATTTGAGG + Exonic
1061797462 9:133095778-133095800 TGGCTCAGCCTCCAAATAGTTGG + Intergenic
1061802937 9:133121931-133121953 GGGCTTTGCCCCAAAAAGGTAGG - Intronic
1062174896 9:135156075-135156097 TGGCTGTGCAACCAAAGGGAGGG - Intergenic
1186357988 X:8807388-8807410 GGGTTTAGCCACCAAATGGAAGG + Intergenic
1187192055 X:17044594-17044616 CATCTTTGCCACCAAATCGTTGG + Intronic
1187706807 X:22017413-22017435 TGTCTTTGCCACTAAATGCTGGG + Intergenic
1188352508 X:29149651-29149673 TGGCTTTGCCATCAACTTCTTGG - Intronic
1192536492 X:71932879-71932901 TGGCTTTGCCACTTATTGGCAGG - Intergenic
1194935168 X:99939506-99939528 TGGCTCTGGTACCAAATAGTTGG - Intergenic
1195411536 X:104571780-104571802 TTGAGTTCCCACCAAATGGTTGG - Intronic
1196211014 X:112995853-112995875 TGGGGTTGCCATGAAATGGTGGG + Intergenic
1199107208 X:143884135-143884157 TGGCTCTGCCAGCAAACGCTGGG - Intergenic
1199849699 X:151716570-151716592 TGGATTTTCCTCCAAATGGCAGG - Intronic