ID: 981364792

View in Genome Browser
Species Human (GRCh38)
Location 4:143889876-143889898
Sequence CTGTGTGAACTTAAGCAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981364792_981364794 -3 Left 981364792 4:143889876-143889898 CCGACTTGCTTAAGTTCACACAG 0: 1
1: 0
2: 6
3: 30
4: 191
Right 981364794 4:143889896-143889918 CAGCAGCCAAGTGGCAGAGCTGG 0: 1
1: 1
2: 30
3: 191
4: 1090

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981364792 Original CRISPR CTGTGTGAACTTAAGCAAGT CGG (reversed) Intronic
902395245 1:16128910-16128932 CTGTGTGACCTCAGGCAAGCCGG + Intronic
903360689 1:22775227-22775249 CTGTGTGCACTTATGCAGGTTGG + Intronic
906613930 1:47222335-47222357 CTGTGTGACCTTGATCAAGCTGG + Intronic
907955033 1:59220186-59220208 TTGTGTGACTTTGAGCAAGTTGG - Intergenic
908437814 1:64123485-64123507 CTGTGTGATCTTGGGAAAGTTGG + Intronic
908569926 1:65398744-65398766 CTGTGTGAACTCAGAAAAGTGGG + Intronic
908774070 1:67623452-67623474 CTGTGTTCACATAAGTAAGTAGG + Intergenic
909461747 1:75923790-75923812 CTGTGTGATTTTGAGCAAGTTGG + Intronic
909774902 1:79471594-79471616 CAGTGAGAACTTGGGCAAGTAGG + Intergenic
910326360 1:86012647-86012669 CTGTGTGAACATAAGACTGTGGG - Intronic
910434416 1:87190730-87190752 TTGTGTGACCTTAAGCAACAGGG + Intergenic
910456999 1:87408399-87408421 CTGCTTGTACTTCAGCAAGTGGG + Intergenic
911622604 1:100082339-100082361 CCGTGGGAACTAAAGGAAGTGGG + Exonic
911809711 1:102260447-102260469 CTGTGAGAACCTAAGTAAGCCGG - Intergenic
913477225 1:119249818-119249840 CCATGTGAACTTAAGAAAGCTGG + Intergenic
915366367 1:155319029-155319051 CTGTGTGACCTTGAGCAAGTCGG + Intronic
916391455 1:164335329-164335351 CTGTGTGACCTTGGGTAAGTGGG + Intergenic
920246015 1:204588270-204588292 CTGTGTGATCTCAAGCAAACTGG - Intergenic
922570659 1:226633024-226633046 GTGTGTGACCTTTAGCAAGTCGG + Exonic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1063131202 10:3179019-3179041 TAGTGTGAATTTAAGTAAGTGGG - Intergenic
1068939035 10:62662810-62662832 CTGTGTCAACTTAGCTAAGTTGG - Intronic
1069273615 10:66562362-66562384 GTGTGTGAACATCAGCCAGTTGG - Intronic
1069814092 10:71182420-71182442 CTGTGTGGCCTTGGGCAAGTAGG + Intergenic
1069818975 10:71216121-71216143 CAGTGTGACCTTGGGCAAGTTGG - Intronic
1069905032 10:71727209-71727231 CTGTGTGACCCTGAACAAGTCGG - Intronic
1072424147 10:95315163-95315185 CTGTCTCAACTCAAGCGAGTGGG - Intronic
1072531600 10:96324548-96324570 CTGTGTGATCTTGAGCAAGTTGG + Intronic
1073490744 10:103851585-103851607 CTGCGAGACCCTAAGCAAGTTGG + Intronic
1075659087 10:124181006-124181028 CTGTGTGATCTTGGGCAAGTTGG - Intergenic
1075813613 10:125247065-125247087 CTGGGTGAACTTGAGCAGATTGG + Intergenic
1075982973 10:126757012-126757034 CTGGATTAACTTGAGCAAGTAGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078104311 11:8349136-8349158 CTGTGTGACCTTAGACATGTTGG + Intergenic
1078464028 11:11537193-11537215 CTGTGTGACTTTAGGCAAGCTGG - Intronic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1079029991 11:16979455-16979477 CTGTGTGACCTTGAGCAAGGTGG - Intronic
1080024992 11:27604076-27604098 CATTGTGAACTTTAGCAAGTAGG - Intergenic
1080720037 11:34839737-34839759 GTATGTGAACTTGAGCAAGCTGG + Intergenic
1080925182 11:36748811-36748833 CTGTGTGGCCTTAAGCAAGTTGG - Intergenic
1081572863 11:44302394-44302416 CTGGGTGCACTTAACCATGTGGG + Intronic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1083925358 11:65802901-65802923 CCGTGTGACCTTGAGCAAGATGG - Intergenic
1085799149 11:79571992-79572014 CTGTGTGATCTCAAGCAAGTTGG - Intergenic
1085886661 11:80530821-80530843 CTATGTGAACTTGGGCAAGTTGG - Intergenic
1086148886 11:83586745-83586767 CTGTGAAAACTTACGCAAGCTGG - Intronic
1086151328 11:83614045-83614067 CAGTGTGAACTTGATGAAGTAGG + Intronic
1086498389 11:87427025-87427047 CTGTGTGATGATATGCAAGTTGG + Intergenic
1088055645 11:105573111-105573133 CTGATTTAACTTTAGCAAGTTGG - Intergenic
1089784196 11:120896285-120896307 CTCTGTGACCTCAGGCAAGTTGG + Intronic
1091589052 12:1832243-1832265 CTGTGTGATCTTGAGAAAGCTGG + Intronic
1092710681 12:11334099-11334121 CTGTGACAAATTAAACAAGTAGG - Intergenic
1092715405 12:11384178-11384200 CTGTGACAAATTAAACAAGTAGG - Intronic
1094390247 12:29941123-29941145 CTGTGACAATTTAAGCAAGAGGG + Intergenic
1096200758 12:49680843-49680865 CTGTGTAACCTTGAGCCAGTTGG - Intronic
1099954131 12:89336362-89336384 CTGTCTGACGCTAAGCAAGTTGG - Intergenic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1101740596 12:107496969-107496991 AGGTGTGAACTTAAGGTAGTAGG + Intronic
1102017163 12:109655606-109655628 CAGGGTGACCTTCAGCAAGTGGG - Intergenic
1102096924 12:110248259-110248281 CTGTGAGAATTCAAACAAGTTGG + Intergenic
1102209781 12:111117934-111117956 CTGTGTGACCTTGGGCATGTTGG - Intronic
1102640130 12:114360176-114360198 CTGAGTGACCTTCAGCAAGTTGG + Intronic
1103759993 12:123242145-123242167 ATCTCTGAACTTAACCAAGTTGG + Intronic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1105564910 13:21535717-21535739 CTGTGTAACCTTGGGCAAGTTGG - Intronic
1106070046 13:26401853-26401875 CTGTGTGACCTTGGACAAGTAGG + Intronic
1107986320 13:45779589-45779611 CTGGGTGATCTTAAGCAAGTTGG + Exonic
1108012714 13:46036442-46036464 CTGTTTGAAGGTAAGCAATTAGG + Intronic
1112109273 13:96276461-96276483 CTGTGTGATGCTCAGCAAGTTGG + Intronic
1115119561 14:29924797-29924819 CAGTGTGGAGTTAAGGAAGTGGG - Intronic
1116559765 14:46362941-46362963 CTCTGCCAACTTAACCAAGTTGG - Intergenic
1117706858 14:58478630-58478652 CTGTGTGAACTTGTGAAACTGGG - Intronic
1119788406 14:77329126-77329148 CTGTCTGTCCTGAAGCAAGTGGG + Exonic
1120188538 14:81419299-81419321 TTGTGTGACCTTGAGAAAGTTGG - Intronic
1121830750 14:97050082-97050104 CTGTGTGATCTGTAGCAAGTAGG + Intergenic
1124070678 15:26390396-26390418 CTGTTTGATCTTAGACAAGTAGG + Intergenic
1124148113 15:27149957-27149979 CTGTGTGATCTTGGGCAAGTAGG + Intronic
1126572548 15:50167731-50167753 GTGTGTGGCTTTAAGCAAGTTGG + Intronic
1126714228 15:51497046-51497068 CTGTGGGACATTAAGAAAGTAGG - Intronic
1129952352 15:79603001-79603023 CTATGTGACCTTCAGCAAGTTGG - Intergenic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1135040163 16:19112282-19112304 GTGCGTGCACTTAAGCCAGTTGG + Intergenic
1135063661 16:19291409-19291431 CTGTGCGATCTTGGGCAAGTTGG + Intronic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136607590 16:31346897-31346919 CTGTGAGAACTTGAACCAGTGGG - Intergenic
1139745182 16:69068419-69068441 CTGTGTGAACCTGGGCAAATTGG + Intronic
1140791032 16:78391414-78391436 CTTTCTCAACTTGAGCAAGTAGG + Intronic
1141383162 16:83594352-83594374 CAGTGAGAACATAAGCAACTTGG + Intronic
1141974202 16:87503909-87503931 CTGTGTGATCCTAATCACGTTGG + Intergenic
1142035238 16:87858589-87858611 CTGTGTGACTTTCACCAAGTGGG - Intronic
1144044999 17:11447484-11447506 CTGTGTTAACTCAAGGAAGGTGG - Intronic
1144780338 17:17805177-17805199 ATGTGTGGTCTTGAGCAAGTTGG + Intronic
1149489078 17:57068998-57069020 CTGTGTAAACTTGAATAAGTTGG + Intergenic
1150496121 17:65609083-65609105 CTGTGTAAACTATAGAAAGTGGG + Intronic
1150614840 17:66762442-66762464 CTGTGTGACTTTGGGCAAGTTGG - Intronic
1151053953 17:71010900-71010922 CTGTGTGACCTCATGTAAGTGGG + Intergenic
1155460613 18:26078205-26078227 CTGTTTGTACTTAGGCAGGTAGG - Intronic
1156126346 18:33910271-33910293 CACTGTGAACTTAAGTAAGCTGG + Intronic
1156130160 18:33963149-33963171 CTGTGTCAAATTAAGTAACTTGG - Intronic
1157988465 18:52466916-52466938 CTGTGTAAGCTTGGGCAAGTTGG - Intronic
1158419594 18:57280985-57281007 CTTTGTGAACTTGAGCACATTGG + Intergenic
1162153268 19:8660178-8660200 CTGTGTGACCCTAGGCAAGTCGG + Intergenic
1165891111 19:39112730-39112752 CTGTGTGACCATGGGCAAGTCGG + Intergenic
928697783 2:33867486-33867508 CTGTTTGACCTTCAGCAAATTGG - Intergenic
932463916 2:71901226-71901248 ACGTGTGATCTTGAGCAAGTTGG - Intergenic
932876070 2:75453898-75453920 CAGTTTGAACATAAACAAGTGGG + Intergenic
935639605 2:105278533-105278555 CCGCGTGACCTTGAGCAAGTAGG + Intronic
936973104 2:118193361-118193383 TTGTGTGACCTTGAGCAAGAAGG - Intergenic
937159790 2:119749365-119749387 ATGTGTCAGCTTTAGCAAGTAGG + Intergenic
940261191 2:151781211-151781233 CTCTGTGATCTTGGGCAAGTTGG - Intergenic
941348402 2:164400166-164400188 ATGTGAGAACTTAAGCAACAAGG - Intergenic
941455936 2:165712326-165712348 CTGTGTGTAATGAAGCAGGTTGG + Intergenic
942130273 2:172871913-172871935 CTGTGTGACTCCAAGCAAGTTGG - Intronic
942214815 2:173708441-173708463 CTGTGTGACCTTAGACAATTTGG - Intergenic
942498944 2:176568029-176568051 CTGTGTGAATATAAGCAAATTGG + Intergenic
943472690 2:188314476-188314498 CTGTGTGACCTTGGGCAAGTGGG - Intronic
943797949 2:192021795-192021817 CTGTGTGAGCTGAAGTAAGGAGG + Intronic
944337010 2:198545976-198545998 CTCTGTGAAATGAAGCAAATAGG - Intronic
944881109 2:204013879-204013901 CAGGATGAACTTAGGCAAGTAGG + Intergenic
945144774 2:206726778-206726800 CTGTGTATACTTAATTAAGTTGG + Intergenic
945287518 2:208097194-208097216 CTGGGTGGACTTGAGCAGGTAGG - Intergenic
947134322 2:226961923-226961945 CTATGTGAACCTGAGTAAGTGGG - Intronic
947788338 2:232845105-232845127 CTGTGTGACCTTGGGCAAGAGGG + Intronic
948370367 2:237485584-237485606 GTGTGTGAGGTTAAGCATGTGGG - Intronic
1169784715 20:9347174-9347196 GGGTGTGGACTTTAGCAAGTTGG + Intronic
1171335790 20:24384269-24384291 CTGTTTGAATTTGGGCAAGTTGG - Intergenic
1172307004 20:33887974-33887996 ATGTATTAACTCAAGCAAGTAGG - Intergenic
1172773040 20:37392643-37392665 CTGTGTGACCTTGAGCAAAGAGG + Intronic
1173721388 20:45261110-45261132 CTGTGTCATCTTGGGCAAGTGGG - Intergenic
1174357112 20:50005845-50005867 CTGTGGGGACTGAAGGAAGTGGG + Intergenic
1174385865 20:50188465-50188487 CTGTGTGACCTTAGGCAAAATGG - Intergenic
1178307924 21:31506057-31506079 CTGTGGGACCTTGAGCAAGTTGG - Intronic
1178586045 21:33871871-33871893 CTGTGTGCTCTTGGGCAAGTTGG + Intronic
1179975730 21:44864866-44864888 CTGTGTGACCTTCAACAAGAGGG - Intronic
1181018076 22:20082764-20082786 CTGTATGACCTTGAGCATGTGGG + Intronic
1181271060 22:21658624-21658646 CTGTGTGATCCTGAGCAAGTTGG + Intronic
1181983811 22:26785118-26785140 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
1183159485 22:36102426-36102448 CTGTATGATCTTGGGCAAGTTGG - Intergenic
1183265655 22:36823652-36823674 CTGTGTGATCCTGAGCCAGTTGG + Intergenic
949290665 3:2461844-2461866 CTGTGTGACCCTAAGCAACTTGG - Intronic
949763692 3:7501558-7501580 CTGTGTGACCTTAAACACATAGG - Intronic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
951326982 3:21314154-21314176 ATGTTTGAACTAAAACAAGTAGG + Intergenic
954069123 3:48130121-48130143 ATGGGTGATCTTGAGCAAGTTGG + Intergenic
954533786 3:51342966-51342988 CTGTGTGAGCCTAAGACAGTGGG - Intronic
955845312 3:63156430-63156452 CTGTGTGAAATGAAGAAACTGGG - Intergenic
956262209 3:67356460-67356482 CTGTGTGATCTTAGGAAAGCTGG + Intergenic
956904631 3:73753033-73753055 GTGTGTGAGCTTCAGCAAGCCGG + Intergenic
956916257 3:73874714-73874736 CAGTGTGACCTTGAGCAAGACGG + Intergenic
958466024 3:94459798-94459820 CTGAGAAAACTTAAGCAGGTAGG - Intergenic
958786501 3:98602440-98602462 ATTTGTGAACTTAGGCAATTAGG + Intergenic
962424629 3:135258879-135258901 TTGGGTAAACTTAAGCTAGTTGG + Intronic
963544213 3:146634431-146634453 CTGTGTGAACTGAAGAAAAGAGG - Intergenic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
965011300 3:163095593-163095615 CTGTGTTACCTTGGGCAAGTTGG + Intergenic
965186432 3:165471345-165471367 CTGTGTGAACCTAAGGGTGTGGG - Intergenic
966643068 3:182211764-182211786 GTGTGTGACCTTAGGCAAGCTGG + Intergenic
970500514 4:16672207-16672229 CTGTGTGACCTTCAGTGAGTTGG - Intronic
970625835 4:17879981-17880003 TTTTGTGAGCTTAATCAAGTTGG - Intronic
971342053 4:25779873-25779895 CTGTGTGGACTTGGGCATGTTGG + Intronic
972577552 4:40365622-40365644 CTGTGTCATATTAAGGAAGTTGG - Intergenic
975822359 4:78285002-78285024 CTGTTTGATATTGAGCAAGTTGG - Intronic
975975074 4:80086172-80086194 CAATGTGAACTGAAGCAATTAGG - Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
979695687 4:123610677-123610699 CTGTGTGACCTTGGGAAAGTTGG - Intergenic
979746172 4:124215959-124215981 CTGTGTGAACCTGGTCAAGTTGG - Intergenic
981364792 4:143889876-143889898 CTGTGTGAACTTAAGCAAGTCGG - Intronic
981751589 4:148097530-148097552 CTATGTGACTTTTAGCAAGTAGG - Intronic
983497105 4:168455294-168455316 GTGTGTGTACTTATGCAAGCAGG + Intronic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
989135381 5:38149305-38149327 CTGTGTGATCTTAGGCAACAAGG - Intergenic
989149699 5:38286759-38286781 CTGTGTAAACTATAGCAAGATGG - Intronic
989765588 5:45078910-45078932 CTGTGTGAATTTATGCAAATTGG + Intergenic
992853743 5:80838746-80838768 CTGTGAGATCTTAGGCAAGTCGG - Intronic
997612833 5:135227213-135227235 CTGTGTAGCCTTCAGCAAGTTGG - Intronic
998730553 5:145070851-145070873 CAGTAAGAATTTAAGCAAGTTGG - Intergenic
1000562101 5:162802191-162802213 CTGTGTGAACATGAACAAGAGGG - Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1005418914 6:25629333-25629355 CGGTGTGACCTTGAGCTAGTTGG - Intergenic
1009370752 6:62898652-62898674 CTGTGGAAACTTAAGTAAGAAGG + Intergenic
1010112632 6:72258106-72258128 CTGTGTGTACTTTTGCCAGTAGG + Exonic
1010769272 6:79810130-79810152 CTGTGTGAGCTTAAGGCAGAAGG + Intergenic
1012259819 6:97074702-97074724 CTTTGTGTACTAGAGCAAGTAGG + Intronic
1013000894 6:106021121-106021143 GTGTGTGCACTAAATCAAGTTGG + Intergenic
1014663612 6:124206366-124206388 CTGTGTTCCCTTAAGCAAGTAGG - Intronic
1015992587 6:138962198-138962220 CTTTGTGTCCTTTAGCAAGTAGG + Intronic
1017267766 6:152470137-152470159 CTGAGTGAACTTGATGAAGTAGG + Intronic
1017402839 6:154084046-154084068 CTGTATGAAATTAAGCAAAGAGG - Intronic
1017708390 6:157145612-157145634 ATGTGTGAATTTAAGAAAGCCGG + Intronic
1021670790 7:23033002-23033024 CTGTGTGACCTTGATCAAGTTGG - Intergenic
1022324787 7:29321455-29321477 CTGGGTGACCTTGGGCAAGTGGG - Intronic
1025778616 7:64579704-64579726 CTTTGAGAACTTAAATAAGTAGG + Intergenic
1030881465 7:114885789-114885811 CTCTTTTTACTTAAGCAAGTTGG - Intergenic
1032564001 7:132922066-132922088 CTTTGTGAGCTTAAGAAAGCTGG - Intronic
1033108380 7:138552452-138552474 CTGTGAGAAATTAAGAAAGAAGG - Intronic
1034106250 7:148493092-148493114 CTGTGCGAGCTTAAACAAGAAGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1037335702 8:17789599-17789621 GTGTGTGTAGTTACGCAAGTTGG + Intronic
1039516937 8:38141770-38141792 CAGTGTAAAATTAAACAAGTGGG + Intronic
1042534980 8:69849827-69849849 CTGTGTGAATTTGGGCACGTTGG - Intergenic
1043550402 8:81365428-81365450 CTTGGTGAATTTAAGCAACTGGG + Intergenic
1043614709 8:82111504-82111526 CTGTGTGTACTAGATCAAGTGGG - Intergenic
1044390612 8:91646094-91646116 CTGTGTGTGCCTGAGCAAGTAGG - Intergenic
1044537171 8:93370522-93370544 CTGTGTGGCCTTGGGCAAGTTGG - Intergenic
1045835182 8:106512184-106512206 CTGTGTGACCTTGGGCAATTGGG - Intronic
1048344218 8:133565022-133565044 CTGTGTGGCCTTAGGCAAGGGGG + Intronic
1052560645 9:30079041-30079063 CTCTGTGACCTTGGGCAAGTGGG + Intergenic
1057328395 9:94088613-94088635 CTGTGTGATCTTAGGCAAACAGG - Intronic
1057402960 9:94740786-94740808 CTGTGTAACCTTAAGCAAGCTGG + Intronic
1057872824 9:98731105-98731127 CTGTGTGACCTCAACAAAGTTGG + Intergenic
1059007046 9:110414355-110414377 ATGTGTGAACTTAGGTAAGGTGG - Intronic
1059033953 9:110733297-110733319 CTTTGTTAATTTAAGTAAGTTGG - Intronic
1059723821 9:116986718-116986740 CTTTGTGACCTTCAGCAAGCAGG - Intronic
1060267739 9:122122087-122122109 CTGTGTGATCTTGGGCAAGTGGG - Intergenic
1061640560 9:131951531-131951553 CTGTGAGAACTTGAGCATCTAGG - Intronic
1061780590 9:132993993-132994015 CTGTGTGACTTTGGGCAAGTAGG - Intergenic
1187125269 X:16448630-16448652 CTGTGTGACCTTGGGCAAGGTGG + Intergenic
1188762548 X:34050419-34050441 ATTCATGAACTTAAGCAAGTAGG + Intergenic
1188836430 X:34961681-34961703 CTGTGGGTACTTTAGCAAGAAGG + Intergenic
1189595916 X:42565212-42565234 GGGTGTGAACTTTAACAAGTTGG + Intergenic
1192100315 X:68257445-68257467 CTGTGTGACCTTGAACAAGTAGG + Intronic
1193535117 X:82705356-82705378 CTTTGTTATCTCAAGCAAGTAGG - Intergenic
1193770511 X:85582100-85582122 CTGTGTGATCCTGGGCAAGTTGG - Intergenic
1197898991 X:131348189-131348211 CTGTGAGGAATTAAGCAACTAGG - Intronic
1198194089 X:134342606-134342628 CTGTGTGACCTTGAGCAAGTTGG + Intergenic
1198965159 X:142220425-142220447 CTCTGTGATCTTGGGCAAGTCGG + Intergenic
1201947009 Y:19521952-19521974 CTGTGTGCAATTCAGTAAGTTGG + Intergenic