ID: 981364847

View in Genome Browser
Species Human (GRCh38)
Location 4:143890578-143890600
Sequence GGATTCTGATGTGCGGCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981364842_981364847 18 Left 981364842 4:143890537-143890559 CCTTGACTGCATGGTAGAATCAT 0: 3
1: 0
2: 14
3: 63
4: 339
Right 981364847 4:143890578-143890600 GGATTCTGATGTGCGGCCAGCGG 0: 1
1: 0
2: 2
3: 18
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981364847 Original CRISPR GGATTCTGATGTGCGGCCAG CGG Intronic
901603001 1:10436803-10436825 GGAGTCTGGGGTGCAGCCAGAGG + Intronic
902399011 1:16147389-16147411 TGATCCTGATATGCAGCCAGGGG + Intronic
902659577 1:17891840-17891862 GGGTTGTGATGGGCGGCCAGGGG - Intergenic
906698370 1:47840035-47840057 GGATTCTGTTCTGGGGCCTGGGG + Intronic
908234289 1:62135162-62135184 TGATTCTAATATGCAGCCAGGGG + Intronic
908775077 1:67631918-67631940 GGATTCCCAGGTGCAGCCAGAGG - Intergenic
912457957 1:109811442-109811464 GGAATCTGCTGTGCTGCAAGAGG - Intergenic
912795394 1:112689995-112690017 GGCTTCAGCTGTGCAGCCAGGGG - Exonic
914096257 1:144546668-144546690 GGACTCTCATGTCCAGCCAGTGG + Intergenic
915022840 1:152797542-152797564 AGATTCTGATGTGTTGTCAGTGG - Intronic
915520031 1:156436566-156436588 GGACTGGGATGTGGGGCCAGGGG + Intergenic
917893943 1:179467927-179467949 GGATCCTAATGTGGGTCCAGTGG - Intronic
919153467 1:193730293-193730315 TGATTCTGAAGCGCTGCCAGTGG - Intergenic
921187780 1:212684810-212684832 GGATTATGATGTGGAGCCAGGGG + Intergenic
921455735 1:215368981-215369003 GCAGTCTGATTTGCGACCAGAGG + Intergenic
923465418 1:234243928-234243950 GGATTCTGTGATGTGGCCAGTGG - Intronic
1063127693 10:3150130-3150152 GCCTTCTGTTGTGGGGCCAGAGG - Intronic
1064063882 10:12163849-12163871 TGATTCTAATGTGCAGCCAAAGG + Intronic
1064449007 10:15425113-15425135 TGATTCTAATGTGCAGCCACAGG - Intergenic
1065046050 10:21748294-21748316 GGAATCTGAGGAGCCGCCAGGGG + Intergenic
1065797789 10:29323077-29323099 CGATTCTCCTGTGCCGCCAGGGG - Intergenic
1067289540 10:44931274-44931296 GGATTCTGATGTGAGTCTAGGGG + Intronic
1067932898 10:50581229-50581251 TGATTCTAATGTGCAGCCAGTGG + Intronic
1069144550 10:64873879-64873901 TGATTCTGTTCTGCGGCGAGCGG + Intergenic
1069874454 10:71553138-71553160 TGATTCTAATATGCAGCCAGGGG + Intronic
1070724045 10:78775943-78775965 AGATTCTAATGGGCAGCCAGGGG + Intergenic
1071927522 10:90427757-90427779 GGATTCTGATGTGATGCCTCAGG + Intergenic
1072882820 10:99245213-99245235 TGATTTTAATGTGCAGCCAGGGG - Intergenic
1073392039 10:103186955-103186977 AGATTCTAATGTTAGGCCAGGGG + Intronic
1074911162 10:117910371-117910393 AGATTCTAATGTGCAGCCTGGGG - Intergenic
1075761913 10:124863802-124863824 GGATTCTGAAGTGCAGCCAGGGG - Intergenic
1075762476 10:124866983-124867005 GGATTCTGAAGTGCAGCCAGGGG + Intergenic
1076127487 10:127986827-127986849 GGATTCTGAAGGCCGGCCCGGGG - Intronic
1077093757 11:790817-790839 GGCTTCTGAAGTGTGGTCAGGGG + Exonic
1078805987 11:14704318-14704340 TAATTCTAATGTGCAGCCAGAGG + Intronic
1079021421 11:16912272-16912294 GCATTCTAATGTGCAGCCAGGGG + Intronic
1080778646 11:35409970-35409992 GGATTCTGATGGGCAGGCTGGGG - Intronic
1081841870 11:46208180-46208202 GGATTGTGAGGTGGGGGCAGGGG - Intergenic
1082753168 11:57044665-57044687 GGATTCTGCAGAGCAGCCAGTGG + Intergenic
1091323708 11:134668914-134668936 GGGATCTGATGTGCTGCCTGGGG + Intergenic
1096657037 12:53098215-53098237 GGAAGCTGAGGTGCAGCCAGGGG + Intronic
1101760239 12:107652297-107652319 TGATTCTGATGTGTGCTCAGGGG + Intronic
1102862752 12:116350737-116350759 GGAGGCTGAGGTGAGGCCAGAGG + Intergenic
1105898111 13:24734901-24734923 TGATCCTAATGTGCAGCCAGAGG + Intergenic
1106332261 13:28750058-28750080 GGACTCTGATGGGCTGACAGAGG - Intergenic
1106646526 13:31639857-31639879 GGATTCTGATCCTCTGCCAGAGG - Intergenic
1108095119 13:46893468-46893490 TGATACTGATGTGCAGCCAGGGG - Intronic
1109374666 13:61476321-61476343 GGATTCAGATGTGAGAACAGAGG - Intergenic
1111980356 13:95008908-95008930 GGTTTCTGTTGAGCGGCAAGAGG + Intergenic
1113461436 13:110485032-110485054 GGCTTCTGACCTGCAGCCAGGGG + Intronic
1117454718 14:55885593-55885615 GGATTATTCTCTGCGGCCAGAGG - Intergenic
1121618777 14:95331949-95331971 GGATTCTGATCTCTGGACAGTGG - Intergenic
1122296316 14:100708364-100708386 GGGTTCAGATGGGCAGCCAGGGG + Intergenic
1202927235 14_KI270724v1_random:37858-37880 TGATTCTCATGTGCACCCAGGGG - Intergenic
1123937959 15:25203072-25203094 GGACACTGATGTGGGGCCAGCGG - Intergenic
1127324315 15:57880642-57880664 GGATCCTGATTTGGAGCCAGAGG - Intergenic
1128979661 15:72176822-72176844 TGATTCTAATGTGCACCCAGCGG - Intronic
1130084007 15:80762058-80762080 GGATTCTGAGGTCCAGGCAGTGG - Intergenic
1130131176 15:81144144-81144166 CGATTCTAACGTGCAGCCAGAGG - Intronic
1134044078 16:11088646-11088668 GGGCTGTGATGTGCGGCTAGAGG + Intronic
1134306986 16:13041862-13041884 GGATTCTGATGTAGCTCCAGGGG + Intronic
1138038136 16:53629261-53629283 CGATTCTCATGTGCAGCCAAGGG + Intronic
1140985427 16:80154007-80154029 GGATACTGATGTGTGGGCTGAGG - Intergenic
1141168604 16:81677094-81677116 GGATCCTGGTGTCCCGCCAGGGG + Intronic
1141349786 16:83283612-83283634 AGATTGTAATGTGCAGCCAGGGG + Intronic
1143100270 17:4500770-4500792 GAATTCTGATGGGAGGGCAGAGG + Intronic
1144406939 17:14960978-14961000 GGATTCTAATATGCAGCCAAGGG + Intergenic
1144777443 17:17791881-17791903 GGATTCTGCTCTGCAGGCAGGGG + Intronic
1146516706 17:33495266-33495288 GGATTCTGATGGGTACCCAGGGG + Intronic
1150173450 17:63023776-63023798 GGATTCTGATTTGGTGGCAGAGG + Intronic
1151393680 17:73804753-73804775 GTATTCTGATGTGCTCCCGGAGG + Intergenic
1151620617 17:75242769-75242791 GGCTTCTGCTGTGTGGCCATGGG + Intronic
1156958860 18:42998575-42998597 TGATTCTAATGTGCAGCCAGAGG + Intronic
1160445482 18:78924320-78924342 GGATTCTGAAGGGCGGCCACAGG - Intergenic
928257830 2:29740106-29740128 GCATTCTGATGTGAGGTCAGAGG + Intronic
930701152 2:54457933-54457955 GGAATCTGATCTGCGACCAGGGG + Intronic
930853503 2:55987239-55987261 GGATTGTAATGTGCAGCCAAAGG - Intergenic
937091018 2:119206245-119206267 TGGTTCTGAGGTGGGGCCAGAGG - Intergenic
937299655 2:120831444-120831466 GGATGCTGATGTCAGGCCAGAGG + Intronic
938621449 2:133059004-133059026 ATATTCTGATATGCAGCCAGGGG + Intronic
942313643 2:174679555-174679577 TGATGCTGATGTGCTACCAGAGG - Intronic
945302626 2:208228154-208228176 GGCTCCTCAAGTGCGGCCAGTGG + Intergenic
948282885 2:236761916-236761938 TGATTCTGATGAGCAGCCAGGGG - Intergenic
1170785736 20:19465810-19465832 TGATTCTAATGTGCTTCCAGTGG - Intronic
1171781339 20:29421317-29421339 TGATTCTCATGTGCACCCAGGGG + Intergenic
1173365888 20:42384405-42384427 GGATTCTGATGGGTGGACAAGGG + Intronic
1174480648 20:50828866-50828888 GGCTTCTGATGTGCCCCCCGTGG - Intronic
1175931818 20:62497114-62497136 GGGATCTGCTGTGGGGCCAGGGG + Intergenic
1179522727 21:41955601-41955623 GGAGTCTGCTGCGGGGCCAGTGG + Intergenic
1183189438 22:36312289-36312311 GGATTCTGATGTCCGGGCTTTGG - Intronic
1183253228 22:36744689-36744711 GGCTTCTGAAGTGGGGCAAGGGG - Intergenic
1183317255 22:37143492-37143514 AGATTCTGCAGTGTGGCCAGTGG + Intronic
950136207 3:10582759-10582781 GGATTGTGATGGGCTACCAGAGG + Intronic
950357877 3:12426921-12426943 TGATTCTAATGTGTGGCCAAGGG - Intronic
950576698 3:13836505-13836527 GGATTCTCACATGTGGCCAGGGG + Intronic
954895349 3:53970511-53970533 GGATTCTGAATTGCGGACTGAGG + Intergenic
955371355 3:58354783-58354805 TGATACTAATGTGCAGCCAGGGG - Intronic
955452497 3:59084877-59084899 AGATTCTGATTTGCAGCCAAAGG - Intergenic
962069676 3:132020329-132020351 GGATTCTGATGTGGAGGCTGAGG + Intronic
964504835 3:157387854-157387876 TGATTCAGATGTGCAGCCAAAGG + Intronic
965895653 3:173572291-173572313 GGATTCTAATGTGCAACCATAGG + Intronic
966106380 3:176340468-176340490 GGATGATCATGTGAGGCCAGGGG + Intergenic
966917497 3:184593129-184593151 GGACTCTGATGTGTGGCCCCAGG + Intronic
967844566 3:194033536-194033558 GGATTCTAACTTGCAGCCAGGGG - Intergenic
968525867 4:1056865-1056887 GGATGCTGATGGGCGGCCGGGGG + Intronic
969659423 4:8517859-8517881 GGAGTGTGAAGTGGGGCCAGTGG + Intergenic
970575104 4:17419503-17419525 TGATTCTGATTTGTAGCCAGAGG - Intergenic
971963676 4:33523015-33523037 GGATTCTGATTTGGGTCAAGAGG + Intergenic
973080433 4:45984684-45984706 GGTTTCTGAGGTTTGGCCAGTGG + Intergenic
979282575 4:118884339-118884361 GGATACTGATTTGCAGCCAATGG - Intronic
979411893 4:120389360-120389382 TGATTCTAATGTGCAGCCACGGG + Intergenic
981000724 4:139826201-139826223 GGATGCTGAGGTGGGGCCCGGGG - Intronic
981364847 4:143890578-143890600 GGATTCTGATGTGCGGCCAGCGG + Intronic
991439353 5:66630178-66630200 TGCTTCTGATGTGCAACCAGGGG + Intronic
992597312 5:78360019-78360041 GGATTCTCAGGTGGGGTCAGGGG + Intergenic
997764619 5:136488179-136488201 GCATTCTGGTATGCGTCCAGAGG - Intergenic
999298413 5:150475040-150475062 GGATTCTGCTGTGCAGACACTGG + Intergenic
1001327377 5:170738953-170738975 TGATTCTGACATGCAGCCAGCGG - Intergenic
1003887077 6:10531521-10531543 TGATTCTCATGTACAGCCAGGGG + Intronic
1004518583 6:16341470-16341492 GGATTCTAATTTGCAGCCAGAGG + Intronic
1006972576 6:38062013-38062035 GGATTCTAATGTGCAGACATAGG - Intronic
1019634196 7:2066911-2066933 GGTTTCTTAAGTGAGGCCAGCGG - Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1023665566 7:42519607-42519629 GGATTCTGATGTCCAGCCTGAGG - Intergenic
1025282113 7:57635195-57635217 GGATTGAGATGTGCTGTCAGGGG + Intergenic
1025302617 7:57830322-57830344 GGATTGAGATGTGCTGTCAGGGG - Intergenic
1026396736 7:69962970-69962992 GCATTCAGATGTTCTGCCAGAGG + Intronic
1028876161 7:95825625-95825647 TGATTCTAATGTGCAGCCAGGGG - Intronic
1030105984 7:105987712-105987734 GGAATCTAATGTATGGCCAGGGG + Intronic
1032788255 7:135219121-135219143 TGATTTTCATGTGCTGCCAGAGG - Intergenic
1033987979 7:147250016-147250038 TGATTCTGATGTGCCTCCAATGG - Intronic
1035224505 7:157425933-157425955 GGGCTCTGATGTGCTGCCCGTGG + Intergenic
1036397459 8:8381444-8381466 GGCCTCTGATGTGTGGACAGAGG - Exonic
1036509468 8:9387146-9387168 GGGTGCTGATGTGAGGGCAGAGG - Intergenic
1038596491 8:28890669-28890691 GGATTCTGAGGTGAGTCGAGCGG + Exonic
1041528956 8:58840810-58840832 GGATTCAGCAGTGTGGCCAGTGG - Intronic
1046713670 8:117543815-117543837 TGATTCTAATGTGCTGCCCGGGG - Intergenic
1048956836 8:139544142-139544164 GGCTTCTGTTGTGAAGCCAGAGG - Intergenic
1049322908 8:142006533-142006555 GGATTCACATGTATGGCCAGCGG + Intergenic
1053246663 9:36540134-36540156 AGATTATGATGTAGGGCCAGGGG + Intergenic
1055612624 9:78038614-78038636 TGATGCTAATGTGCAGCCAGGGG - Intergenic
1203759604 EBV:5266-5288 GGATGCTAATGTTCAGCCAGCGG - Intergenic
1186519071 X:10189470-10189492 TGATTGTAATGTGCAGCCAGGGG + Intronic
1187276855 X:17823822-17823844 TGGTTCTGATGTGCAGCCAGGGG + Intronic
1189095968 X:38140088-38140110 GGATTCTCATGTGAAGCCAAGGG - Intronic
1191677775 X:63809775-63809797 TGATTCTCATGTACAGCCAGGGG - Intergenic
1192150653 X:68710328-68710350 TGATTCTTATGTGCATCCAGGGG + Intronic
1195675034 X:107501576-107501598 TGATTCTAAGGTGCAGCCAGGGG - Intergenic