ID: 981366707

View in Genome Browser
Species Human (GRCh38)
Location 4:143912300-143912322
Sequence CCCGAGCAGCGTCGCAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981366707_981366716 8 Left 981366707 4:143912300-143912322 CCCGCTCTGCGACGCTGCTCGGG No data
Right 981366716 4:143912331-143912353 GAGGAAAGCCCAGCGACGCCGGG No data
981366707_981366715 7 Left 981366707 4:143912300-143912322 CCCGCTCTGCGACGCTGCTCGGG No data
Right 981366715 4:143912330-143912352 TGAGGAAAGCCCAGCGACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981366707 Original CRISPR CCCGAGCAGCGTCGCAGAGC GGG (reversed) Intergenic
No off target data available for this crispr