ID: 981372064

View in Genome Browser
Species Human (GRCh38)
Location 4:143969889-143969911
Sequence GTACACTCATTGGTAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981372064_981372068 -8 Left 981372064 4:143969889-143969911 CCCTTATTTACCAATGAGTGTAC No data
Right 981372068 4:143969904-143969926 GAGTGTACTGAGGTTCAGAGAGG No data
981372064_981372069 11 Left 981372064 4:143969889-143969911 CCCTTATTTACCAATGAGTGTAC No data
Right 981372069 4:143969923-143969945 GAGGTTAACATAATTAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981372064 Original CRISPR GTACACTCATTGGTAAATAA GGG (reversed) Intergenic
No off target data available for this crispr