ID: 981372533

View in Genome Browser
Species Human (GRCh38)
Location 4:143975587-143975609
Sequence AAGTTCCCCTTTAAAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981372533_981372542 13 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372542 4:143975623-143975645 GGCAGGGAAGGAGCAGTTGGGGG No data
981372533_981372544 27 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372544 4:143975637-143975659 AGTTGGGGGTCTAGGTGACTTGG No data
981372533_981372543 19 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372543 4:143975629-143975651 GAAGGAGCAGTTGGGGGTCTAGG No data
981372533_981372535 -8 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372535 4:143975602-143975624 GGGAACTTGGCATGAATGACAGG No data
981372533_981372536 -4 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372536 4:143975606-143975628 ACTTGGCATGAATGACAGGCAGG No data
981372533_981372541 12 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372541 4:143975622-143975644 AGGCAGGGAAGGAGCAGTTGGGG No data
981372533_981372539 10 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372539 4:143975620-143975642 ACAGGCAGGGAAGGAGCAGTTGG No data
981372533_981372538 1 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372538 4:143975611-143975633 GCATGAATGACAGGCAGGGAAGG No data
981372533_981372540 11 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372540 4:143975621-143975643 CAGGCAGGGAAGGAGCAGTTGGG No data
981372533_981372537 -3 Left 981372533 4:143975587-143975609 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981372537 4:143975607-143975629 CTTGGCATGAATGACAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981372533 Original CRISPR AAGTTCCCCTTTAAAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr