ID: 981376285

View in Genome Browser
Species Human (GRCh38)
Location 4:144019798-144019820
Sequence TGTGTGACTCACCATGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 2, 1: 1, 2: 1, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981376285 Original CRISPR TGTGTGACTCACCATGAGTT TGG (reversed) Intergenic
900625271 1:3605168-3605190 TGTGTGACTGAGTATGAGTAAGG - Intronic
901166256 1:7223761-7223783 TCTCTGACTCACCATGAATAAGG + Intronic
903454451 1:23477547-23477569 TGTGTGAGTCACCTGGAGATGGG + Intronic
905937942 1:41839641-41839663 TGTGTGACTACACATGAGTGAGG + Intronic
910627136 1:89318859-89318881 TGTGTGACTGCACATGAGATGGG - Intergenic
911283988 1:95967524-95967546 TGTGTCACTCACCACTAATTTGG - Intergenic
913681184 1:121187738-121187760 TGTGGGGCTGACCATGATTTTGG + Intronic
914033013 1:143975378-143975400 TGTGGGGCTGACCATGATTTTGG + Intergenic
914156432 1:145092588-145092610 TGTGGGGCTGACCATGATTTTGG - Intronic
916582656 1:166122605-166122627 TGTGTGAATCACCCTGAATCTGG + Intronic
920468498 1:206206262-206206284 TGTGGGGCTGACCATGATTTTGG + Intronic
1065176432 10:23080524-23080546 TATGAGACTCCCCATCAGTTGGG - Intergenic
1066578884 10:36858354-36858376 TGTGTAACTGAACATGTGTTTGG + Intergenic
1074425256 10:113345177-113345199 TGAGTGACTCACTTTGATTTGGG + Intergenic
1088343413 11:108795178-108795200 TGTTTGACTCAGAATGATTTGGG + Intronic
1090408121 11:126489587-126489609 TGTGTGAATCACCATAAGTTTGG + Intronic
1090775413 11:129960704-129960726 GATGTGGCTCACCGTGAGTTAGG - Intronic
1091852538 12:3711909-3711931 TGTATGAATCACTATGAGTTTGG + Intronic
1092885967 12:12924624-12924646 TGGATCACTCACCGTGAGTTAGG - Intergenic
1100020353 12:90061990-90062012 TGTGTGACTCACCCTCAGGAGGG + Intergenic
1101961787 12:109256267-109256289 TGTCTGACTCACCAGGCATTGGG + Intronic
1102122361 12:110451574-110451596 TGTGAGACTGACCATGAGGAAGG - Intergenic
1108441716 13:50460060-50460082 TGTATGCCCCACCATGAGCTAGG - Intronic
1108933244 13:55858459-55858481 TGTGTAAATCACCGTGAGTTTGG + Intergenic
1114339359 14:21727073-21727095 TGTTTGACTCAGTGTGAGTTAGG + Intergenic
1116924757 14:50622848-50622870 TGTATTATTCCCCATGAGTTTGG + Intronic
1118113775 14:62751605-62751627 TGTCTGAGTCACCATGCCTTGGG - Intronic
1121499041 14:94419097-94419119 TGTGTAAATCACCAAGACTTGGG - Intergenic
1124796878 15:32790195-32790217 TGGGTGACTGAACATGCGTTTGG - Intronic
1131850894 15:96542288-96542310 TGTGTCACTCCCCAGGAGCTGGG - Intergenic
1133913477 16:10086991-10087013 TGTGTGGATTACCATGAATTGGG + Intronic
1134692427 16:16199663-16199685 TGTGTGACTCACACTGAGCTGGG + Intronic
1134979417 16:18595013-18595035 TGTGTGACTCACACTGAGCTGGG - Intergenic
1135118436 16:19743726-19743748 TGTGTGACTGACCATCAGAGTGG - Intronic
1138366969 16:56488089-56488111 TGTGTAGTTCACCATGAGTGGGG + Intronic
1143205022 17:5135379-5135401 TTTGTGACTCACCAGGATATAGG + Intronic
1148178483 17:45586680-45586702 TGTGTTCCTCACCAAGTGTTTGG + Intergenic
1148270674 17:46259775-46259797 TGTGTTCCTCACCAAGTGTTTGG - Intergenic
1149083878 17:52691130-52691152 TCTGTGACTAACCATCAGCTGGG + Intergenic
1150857074 17:68763519-68763541 TCTGTGACCCAGCATCAGTTAGG - Intergenic
1150992151 17:70271995-70272017 AGTGTGACTCACCTGGACTTTGG - Intergenic
1158396249 18:57080399-57080421 TGTGTCAGTCAGGATGAGTTAGG + Intergenic
1159253490 18:65913139-65913161 GGTGTTAGTCACAATGAGTTGGG - Intergenic
1164254586 19:23516328-23516350 TGTTTAACTCATCATTAGTTAGG + Intergenic
1166568967 19:43781366-43781388 TGTGTGTCACACCATGTGTGTGG - Intergenic
1167878142 19:52431208-52431230 TGTGTCGCTCACCATGAGACAGG + Intronic
1168365581 19:55784221-55784243 TGTGTCAGTCACCATAAGCTGGG - Intergenic
925929992 2:8699195-8699217 TGGGTGATTCATCCTGAGTTTGG + Intergenic
931552629 2:63463436-63463458 TGTGGTACTGACCAAGAGTTGGG + Intronic
931680573 2:64744949-64744971 TGTGTCCCTAACAATGAGTTAGG - Intronic
935311362 2:101787167-101787189 TGAGTGACCCACCATCAGGTGGG + Intronic
936288491 2:111199963-111199985 TGTGTCACTCACCAGGAATAGGG + Intergenic
936574295 2:113640819-113640841 TGTGTGAGTCACCTGGAGATGGG + Intronic
943302140 2:186216585-186216607 TGTATGTCTTAGCATGAGTTTGG - Intergenic
1169284759 20:4298651-4298673 GGTGTGACTCCCCAGGACTTGGG + Intergenic
1171948606 20:31400841-31400863 TGTTTTACTCTCCATGATTTAGG - Intergenic
1182743107 22:32583165-32583187 TGTGTGTCTGTCCATGTGTTGGG - Intronic
1185425877 22:50770069-50770091 TGTGTGAGTCACCTGGAGATGGG - Intronic
950759142 3:15205541-15205563 TCTTTGACTCAGCATGAATTTGG + Intergenic
953996654 3:47524917-47524939 TGTGTCACTCAGCAAGAGATGGG + Intergenic
959212531 3:103405526-103405548 ATTGTGACTTACCATGTGTTGGG + Intergenic
960757146 3:121027714-121027736 TGTTTGGCTGACCATGAGATGGG - Intronic
961321717 3:126081801-126081823 TGAGTGACTCACCAAGACTGTGG - Intronic
963070275 3:141299418-141299440 TGTGTGTCTCTACATGAGATGGG + Intergenic
966940048 3:184740590-184740612 GGTGTGACTGGCCAGGAGTTTGG - Intergenic
968934073 4:3600942-3600964 TGAGTGACTCTCCATGAATCAGG + Intergenic
970308220 4:14754797-14754819 TGTGTGGCAAAGCATGAGTTGGG - Intergenic
972222610 4:36973121-36973143 TGTAGCACTCATCATGAGTTTGG + Intergenic
972791114 4:42372337-42372359 TGTGTGACTCTCCATGCTATAGG - Intergenic
972898480 4:43653936-43653958 TGTGGGCCTCACCCTGAGGTAGG - Intergenic
975176430 4:71294575-71294597 TCTTTGATTCATCATGAGTTCGG - Intronic
981366170 4:143906018-143906040 TGTGTGACTCACCATGAGTTTGG - Intergenic
981376285 4:144019798-144019820 TGTGTGACTCACCATGAGTTTGG - Intergenic
981386797 4:144141146-144141168 TGTGTGGCTCACCATGAGTTTGG - Intergenic
986022046 5:3813294-3813316 TGTGTGACCCAGCATGTGCTAGG - Intergenic
987690111 5:21255260-21255282 TGTGTGCCTCAGGATGAATTTGG - Intergenic
998266561 5:140671520-140671542 TGTGTTCCTCACCAAGTGTTTGG - Exonic
1000264678 5:159623575-159623597 TGTGTGAGTCCTTATGAGTTAGG - Intergenic
1003498373 6:6683805-6683827 TGAGTGGCTCACCTTGACTTGGG - Intergenic
1005284212 6:24307390-24307412 TTTGTGACTGTCCATGAGATAGG + Intronic
1006914283 6:37584710-37584732 TGTGTGCCTCCCCACGAGCTGGG + Intergenic
1009861498 6:69339898-69339920 TGTGTGAAGAAACATGAGTTAGG - Intronic
1011086347 6:83545512-83545534 TGTGTGTCTCTACATGAGATGGG - Intergenic
1011138920 6:84131730-84131752 TGTGTGTCTCCACATGAGATGGG + Intronic
1011675845 6:89732715-89732737 TGGCTGACCCACCAAGAGTTTGG - Exonic
1013179470 6:107706175-107706197 TGTGTCACTCTCCATGTCTTTGG + Intronic
1017593978 6:156008824-156008846 TGAATGACTTACCATGAGTATGG + Intergenic
1019075611 6:169385267-169385289 TGTGTGACAGAACATGAGTGAGG - Intergenic
1020826162 7:13031767-13031789 TGTGTGACTCATAAAAAGTTCGG + Intergenic
1023315793 7:38935036-38935058 TGTGTGATCCAACATGATTTTGG + Intergenic
1023374589 7:39543370-39543392 TGTGTGTCTCTCCATGAGTGCGG - Intergenic
1024026597 7:45414490-45414512 TGTGGGACTCACCAGGGGCTGGG + Intergenic
1031328188 7:120429107-120429129 TGTGTACCACACCGTGAGTTTGG - Intronic
1032590234 7:133185336-133185358 TGACTGACTCACCTTGGGTTGGG - Intergenic
1038713815 8:29973703-29973725 TGTGTGAGACACCCTGTGTTAGG - Intergenic
1039115609 8:34088565-34088587 TGTTTGAGTCACCATGCCTTGGG + Intergenic
1040413446 8:47177883-47177905 TGGGTGTCTCAGCATGAGCTAGG - Intergenic
1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1050082993 9:1934949-1934971 TGTGTCTCTCCCCATGAGATGGG + Intergenic
1050243234 9:3659640-3659662 TGAGTGACCCAGCATGAGTCTGG + Intergenic
1052295408 9:26892247-26892269 TGTGGGGCTCACCAGGACTTAGG + Intronic
1053567811 9:39271413-39271435 TGTGTGGCTCCCCGTGAGTGAGG - Intronic
1054129332 9:61347586-61347608 TGTGTGGCTCCCCGTGAGTGAGG + Intergenic
1054456081 9:65431037-65431059 TGAGTGACTCTCCATGAATCAGG - Intergenic
1057493748 9:95543448-95543470 GGTGTCATTCACCAAGAGTTGGG + Intergenic
1185652698 X:1660415-1660437 TGTGTGACCCAACACGAGTTCGG + Intergenic
1187514794 X:19959270-19959292 TGTGTGACTCAGCAGAAGATGGG - Intronic
1187569742 X:20488898-20488920 TGTATGACTCCCCAGGAGTAAGG + Intergenic
1187675382 X:21711128-21711150 TGTGGGACTCAGCATGTGCTCGG + Intronic
1190107615 X:47571136-47571158 TGTGTGTTTCACCATGAGGCTGG + Intronic
1192704341 X:73513161-73513183 TGTGTCTCTGCCCATGAGTTGGG - Intergenic
1192880905 X:75283156-75283178 TGTGTGAGTCCTCATGTGTTAGG + Intronic
1194506537 X:94740150-94740172 TGTGTGACCTACCATGCATTAGG - Intergenic
1197151937 X:123229662-123229684 TGTGTGCCCCACAATGTGTTAGG - Intronic
1200109377 X:153732532-153732554 TGGGTGACTCACCAAGAGGAAGG + Intronic
1200969554 Y:9136368-9136390 TGTGTGATTCACCTTGGCTTGGG - Intergenic
1202141445 Y:21727872-21727894 TGTGTGACTCACCTTGGCTTGGG + Intergenic
1202145420 Y:21775930-21775952 TGTGTGACTCACCTTGGCTTGGG - Intergenic