ID: 981381148

View in Genome Browser
Species Human (GRCh38)
Location 4:144073091-144073113
Sequence GTACACTCATTGGTAAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981381148_981381152 -8 Left 981381148 4:144073091-144073113 CCCTTATTTACCAATGAGTGTAC No data
Right 981381152 4:144073106-144073128 GAGTGTACTGAGGTACAGAGAGG No data
981381148_981381153 11 Left 981381148 4:144073091-144073113 CCCTTATTTACCAATGAGTGTAC No data
Right 981381153 4:144073125-144073147 GAGGTTAACATAGTTAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981381148 Original CRISPR GTACACTCATTGGTAAATAA GGG (reversed) Intergenic
No off target data available for this crispr