ID: 981381627

View in Genome Browser
Species Human (GRCh38)
Location 4:144078789-144078811
Sequence AAGTTCCCCTTTAAAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981381627_981381638 19 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381638 4:144078831-144078853 GAAGGAGCAGTTGGGGGTCTAGG No data
981381627_981381637 13 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381637 4:144078825-144078847 GGCAGGGAAGGAGCAGTTGGGGG No data
981381627_981381631 -4 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381631 4:144078808-144078830 ACTTGGCGTGAATGGCAGGCAGG No data
981381627_981381633 1 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381633 4:144078813-144078835 GCGTGAATGGCAGGCAGGGAAGG No data
981381627_981381635 11 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381635 4:144078823-144078845 CAGGCAGGGAAGGAGCAGTTGGG No data
981381627_981381634 10 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381634 4:144078822-144078844 GCAGGCAGGGAAGGAGCAGTTGG No data
981381627_981381630 -8 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381630 4:144078804-144078826 GGGAACTTGGCGTGAATGGCAGG No data
981381627_981381636 12 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381636 4:144078824-144078846 AGGCAGGGAAGGAGCAGTTGGGG No data
981381627_981381632 -3 Left 981381627 4:144078789-144078811 CCAGAGCTTTTAAAGGGGAACTT No data
Right 981381632 4:144078809-144078831 CTTGGCGTGAATGGCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981381627 Original CRISPR AAGTTCCCCTTTAAAAGCTC TGG (reversed) Intergenic
No off target data available for this crispr