ID: 981381897

View in Genome Browser
Species Human (GRCh38)
Location 4:144082622-144082644
Sequence TAGGACTTCTTGGGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981381892_981381897 9 Left 981381892 4:144082590-144082612 CCTTCAGGCAGATACAATAGGAT No data
Right 981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG No data
981381890_981381897 21 Left 981381890 4:144082578-144082600 CCGAATCTGGTTCCTTCAGGCAG No data
Right 981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981381897 Original CRISPR TAGGACTTCTTGGGTAAAAA AGG Intergenic
No off target data available for this crispr