ID: 981382791

View in Genome Browser
Species Human (GRCh38)
Location 4:144092502-144092524
Sequence CAGAGTTTCTTGTATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981382788_981382791 -5 Left 981382788 4:144092484-144092506 CCCAAAGCAGATATTCTGCAGAG 0: 3
1: 0
2: 2
3: 17
4: 202
Right 981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG No data
981382789_981382791 -6 Left 981382789 4:144092485-144092507 CCAAAGCAGATATTCTGCAGAGT No data
Right 981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG No data
981382786_981382791 17 Left 981382786 4:144092462-144092484 CCAGTACCTTCTTTCTTTTTGGC No data
Right 981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG No data
981382787_981382791 11 Left 981382787 4:144092468-144092490 CCTTCTTTCTTTTTGGCCCAAAG No data
Right 981382791 4:144092502-144092524 CAGAGTTTCTTGTATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981382791 Original CRISPR CAGAGTTTCTTGTATGAGGT TGG Intergenic
No off target data available for this crispr