ID: 981385862

View in Genome Browser
Species Human (GRCh38)
Location 4:144129845-144129867
Sequence CTCCTTTCCCACTGGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 3, 1: 0, 2: 2, 3: 26, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981385862_981385871 19 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385871 4:144129887-144129909 CTTTGCCACCAAATGGTTGGGGG 0: 2
1: 1
2: 0
3: 12
4: 112
981385862_981385870 18 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385870 4:144129886-144129908 GCTTTGCCACCAAATGGTTGGGG 0: 2
1: 1
2: 2
3: 8
4: 119
981385862_981385868 16 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data
981385862_981385869 17 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385869 4:144129885-144129907 GGCTTTGCCACCAAATGGTTGGG 0: 2
1: 1
2: 1
3: 11
4: 109
981385862_981385865 -4 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385865 4:144129864-144129886 GGAGAGCAGAGTTCTCTTCCTGG 0: 1
1: 2
2: 1
3: 99
4: 5958
981385862_981385866 12 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385866 4:144129880-144129902 TTCCTGGCTTTGCCACCAAATGG 0: 2
1: 1
2: 4
3: 37
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981385862 Original CRISPR CTCCTTTCCCACTGGGACAG TGG (reversed) Intronic
900483676 1:2911304-2911326 GTCAGGTCCCACTGGGACAGTGG - Intergenic
900949991 1:5853180-5853202 CTCCTTCCCCACTGAGGCCGGGG + Intergenic
901187408 1:7384010-7384032 CTCCCTTCCCACTGAAACACAGG + Intronic
902302732 1:15513840-15513862 CTCCTTGCCCATTGTGACACAGG - Intronic
902595268 1:17505355-17505377 CTCTTTTCTCTCTGGGGCAGTGG - Intergenic
902607504 1:17576765-17576787 TTCCTTTCTCACTGGGGCGGTGG - Intronic
903284741 1:22269573-22269595 CTCATCTCCCACTGGCAGAGAGG + Intergenic
903857361 1:26345016-26345038 CTCATTTCCCACCTGGAAAGAGG - Exonic
903976802 1:27155222-27155244 CTTCTTTCCCTCGGCGACAGGGG - Intronic
904300072 1:29548704-29548726 ATCAGTTCCCACTGGGAGAGTGG + Intergenic
904317893 1:29677669-29677691 ATCCTCTCCCACTCAGACAGGGG - Intergenic
904623713 1:31790578-31790600 CTCCTTACCCACCAGAACAGGGG - Exonic
904929871 1:34078224-34078246 CTCCCTTCCCACACAGACAGTGG - Intronic
904944622 1:34190101-34190123 TTCCTTTCCAACTGAGAAAGAGG - Intronic
904973090 1:34434488-34434510 GTTCTTGCCAACTGGGACAGGGG - Intergenic
905382567 1:37573529-37573551 CTCCTTTCCCACTGGATCACAGG + Intronic
906459875 1:46028946-46028968 CTGTTTCCCCACTGGGCCAGGGG - Intronic
909973171 1:82015249-82015271 CTCTCGTCCCACTGGGACTGTGG + Intergenic
910687117 1:89928700-89928722 TTCTTTTCCCACTGGGAAGGTGG + Intronic
911908015 1:103594351-103594373 CTCTTTTCCTACTGGGAATGGGG + Intergenic
911913549 1:103666832-103666854 CTCTTTTCCTACTGGGAATGGGG + Intronic
911914903 1:103685115-103685137 CTCTTTTCCTACTGGGAATGGGG - Intronic
912383141 1:109258327-109258349 CTCCTTTCCAACTGGCATAAGGG - Intronic
913412122 1:118563702-118563724 CTCATCTCCCACTTGCACAGTGG - Intergenic
913543549 1:119844436-119844458 CTGCTTTCTCACTGGACCAGGGG + Intergenic
914260762 1:145997196-145997218 CTCCTTTCCCTCAGAGACGGTGG - Intergenic
914860010 1:151378028-151378050 CTCCTGTCCTTCTGGGACACTGG - Intergenic
915476499 1:156155759-156155781 TTCCTGTCCCACTGGCACATCGG - Intronic
916143245 1:161717936-161717958 CTCCCTTCCCACTGGACAAGAGG + Intergenic
919036544 1:192318324-192318346 CTTCTTTCCCAATTGCACAGAGG - Intronic
919909320 1:202101133-202101155 CTTCTTTCTCACTGGGCCTGAGG + Intergenic
920566800 1:206980614-206980636 CTCCTTTTTCCCTGGGACAGGGG - Intergenic
920857217 1:209673079-209673101 CTCTTTTCCCACCCAGACAGAGG + Intergenic
924507172 1:244696851-244696873 CTGCTTTCCCTCTGGGACTCTGG + Intronic
1063417778 10:5888405-5888427 CATCTTCCCCACTGGGGCAGGGG - Intronic
1063710724 10:8475556-8475578 GTCCCTTCCCACTGGGAGAAGGG - Intergenic
1065188605 10:23191960-23191982 CTCCTTCCGCCCTGGGACTGGGG - Intergenic
1065625621 10:27625828-27625850 CTCCCTTCAAACAGGGACAGGGG + Intergenic
1065811247 10:29445742-29445764 GTCCTTTCCCATTAGGACACAGG - Intergenic
1065823423 10:29548240-29548262 TTTTTTTCCCACTGGGACACAGG - Intronic
1066281139 10:33919377-33919399 CTCCATTCCCAGAGGTACAGGGG + Intergenic
1067689770 10:48494307-48494329 CTCCCTTGCCTCTGGGACAAAGG + Intronic
1069250846 10:66264847-66264869 TTCCTGTCCCTGTGGGACAGAGG - Intronic
1069903496 10:71719323-71719345 CTCCCTTCCCACTGGGGCCAGGG + Intronic
1070282718 10:75061668-75061690 CTCCCACCCCACTGGGACAGCGG - Intergenic
1070918753 10:80171080-80171102 CTCCTCTGCCAGTGGGATAGGGG - Intronic
1072255821 10:93619380-93619402 GTCCTTTCACACAGGGTCAGTGG + Intronic
1072394657 10:95026400-95026422 CTCCCATCTCACTTGGACAGGGG - Intergenic
1074146578 10:110721949-110721971 CTCCTCTCCCAGTTGGAGAGGGG + Intronic
1074227205 10:111496115-111496137 TTCCATTTCCACTGGGACAGAGG + Intergenic
1075983877 10:126766665-126766687 CTCCCATCTCCCTGGGACAGAGG - Intergenic
1076276617 10:129204865-129204887 CTCCTTTTCCTCAGGGAGAGTGG + Intergenic
1076772052 10:132671179-132671201 CTCCCTTCTGATTGGGACAGTGG + Intronic
1076809976 10:132881419-132881441 CTCCTTTCCAGCAGGGACATGGG - Intronic
1079696162 11:23484541-23484563 CTCCCATCTCCCTGGGACAGAGG + Intergenic
1079735543 11:23993459-23993481 CTCCTTTCTCTCTGTGAGAGTGG - Intergenic
1079964240 11:26960984-26961006 CTCTTTTGCCAGTGGGGCAGTGG + Intergenic
1084728235 11:71056056-71056078 CTCCCTCCACTCTGGGACAGCGG + Intronic
1084958637 11:72704449-72704471 CACCTTCCCCATTGGGAAAGTGG - Intronic
1085075096 11:73584071-73584093 CTCCTTTGCTTCTGGGGCAGGGG + Intronic
1085764874 11:79274035-79274057 CTCATTTCCCCCTCGCACAGTGG - Intronic
1087568650 11:99895842-99895864 CTCCTTTCTCAGTGGGGCAGTGG - Intronic
1087655618 11:100919259-100919281 CTCCTTTCCCTCTGGGAGTTTGG - Intronic
1088837891 11:113593891-113593913 CTCCGTCACCACTGGGACTGTGG - Intergenic
1089315481 11:117588311-117588333 GGCCTTTCGCTCTGGGACAGAGG + Intronic
1089387582 11:118078359-118078381 CACCCTTCCCCCTTGGACAGTGG - Intronic
1090347642 11:126083989-126084011 CTCCTCTCACACAGGGAAAGCGG - Intergenic
1090398669 11:126435015-126435037 CTCCTTCCTCTCTGGGACACTGG - Intronic
1091678480 12:2509110-2509132 CCCTTTTCCCACTGGGAGATGGG + Intronic
1091696105 12:2629306-2629328 CCCTTTTCCCACTGGGAGATGGG + Intronic
1093091964 12:14932013-14932035 CCCCTTTCCCACCTGCACAGTGG - Intronic
1098574675 12:72027777-72027799 AGCCTTTCCCACTGGGCCTGCGG - Intronic
1101225358 12:102682720-102682742 CTCCTTTCCTTCTGATACAGTGG + Intergenic
1102001039 12:109558329-109558351 CTCCTTTCCTTCTGGGAGGGGGG - Intronic
1102487645 12:113268922-113268944 CTCCTGCCCCACTGGCCCAGAGG - Intronic
1102929762 12:116853161-116853183 CTGCTTTCGCACTGGTATAGGGG - Intronic
1103083815 12:118046093-118046115 CTGCTTTCACACTGTGACAGCGG + Intronic
1103321187 12:120093647-120093669 CTCCTTTGACCCTGGGCCAGGGG - Exonic
1104509167 12:129360529-129360551 CTCTTTTCACAATGGGATAGTGG + Intronic
1104561883 12:129853184-129853206 CCCCTTTCCCTCTGTGACTGTGG - Intronic
1105435996 13:20378870-20378892 CACGTTCCCCACTGGGACATGGG - Intergenic
1110277620 13:73657797-73657819 CTCCTTTACCACTGATGCAGTGG - Intergenic
1111124432 13:83896156-83896178 AGCCTTTCCCACTGGGTGAGGGG - Intergenic
1112543395 13:100339740-100339762 CTCCTTTTCTCCAGGGACAGGGG + Intronic
1113653491 13:112054233-112054255 CTCCTCTCCCGCCGAGACAGAGG - Intergenic
1113937660 13:114002936-114002958 GTCCTCACCCACTGGGACACAGG - Intronic
1115097164 14:29650467-29650489 CTCCTTTGCCTGTGGGACTGAGG - Intronic
1115940297 14:38601436-38601458 CTCCCATCTCCCTGGGACAGAGG - Intergenic
1117049029 14:51842507-51842529 CTACTCTGGCACTGGGACAGTGG - Intronic
1117309383 14:54506772-54506794 CTCCTTTCCTAGAGGGAAAGTGG - Intergenic
1118385353 14:65251630-65251652 CTCCTTTGCCCCTGGGACCCTGG + Intergenic
1121689934 14:95870623-95870645 AGCCTCTCCCACTGGGAAAGTGG - Intergenic
1122850706 14:104528686-104528708 CTCCTGTCTCACTGGGACAATGG - Intronic
1122905008 14:104797574-104797596 CTGCTTTCCCTCTGGGACGCTGG - Intergenic
1123921260 15:25071397-25071419 CTGCTTTCCAAGTGGGAAAGTGG - Intergenic
1123996071 15:25718816-25718838 CTCCTTGCCCACATGGACGGTGG + Intronic
1124086400 15:26554566-26554588 CTCTCTTCCCACTAGGAAAGTGG + Intronic
1127976088 15:63998358-63998380 AGGCTTTCCCTCTGGGACAGAGG + Intronic
1128357302 15:66937080-66937102 CTGCTTTCACACTGCAACAGTGG - Intergenic
1128692140 15:69732822-69732844 CTGCTATTGCACTGGGACAGAGG + Intergenic
1129444466 15:75607155-75607177 CTCCTCTCCTCCTGGGAAAGCGG - Intronic
1129780592 15:78267945-78267967 CTCGTCTCCCACTGGGAGAAGGG + Intronic
1131083991 15:89560115-89560137 CTCCCTCCCTGCTGGGACAGTGG + Intergenic
1132397529 15:101485482-101485504 CTCCTTTCCCGGTGTGACAAAGG + Intronic
1132501715 16:287367-287389 CTCCTTTACCACGGGGGCTGAGG + Intergenic
1132749691 16:1451864-1451886 CTCCTTGCCCTCTGTGACCGTGG - Intronic
1135145670 16:19960673-19960695 CTCGTTTTCCACCAGGACAGTGG + Intergenic
1135251261 16:20902128-20902150 CTCCATTTCCACTGTGACTGAGG - Intronic
1135892570 16:26370784-26370806 CTCCTTTCTCTCTGGTACAAGGG - Intergenic
1136685843 16:31994569-31994591 CTCCCTGCCTCCTGGGACAGAGG - Intergenic
1136786456 16:32938102-32938124 CTCCCTGCCTCCTGGGACAGAGG - Intergenic
1136883316 16:33915693-33915715 CTCCCTGCCTCCTGGGACAGAGG + Intergenic
1137676353 16:50305617-50305639 CTCCTCTCCCCCTCGGATAGGGG + Intronic
1137896483 16:52218034-52218056 CACCTTTCCTACTGGCCCAGTGG + Intergenic
1137908756 16:52354077-52354099 CTCCTTCCCCTCTGTGTCAGTGG - Intergenic
1138260131 16:55613483-55613505 CTACTTTTCCACTTGGACATTGG + Intergenic
1138442431 16:57043039-57043061 CTCCCCTCCCACGGGGACACTGG - Intronic
1139589527 16:67925861-67925883 CCCCTTCCCCACTGCCACAGAGG - Intronic
1139636295 16:68260425-68260447 CTCCCTTCACCCTGGGACTGTGG + Exonic
1140930484 16:79623114-79623136 CTCCCTTCCCACTGTGGGAGGGG - Intergenic
1142108271 16:88317892-88317914 CATCTTTCTCCCTGGGACAGGGG + Intergenic
1142137105 16:88456524-88456546 CTCGTTTGCCACTGGGACCCAGG - Intronic
1203088690 16_KI270728v1_random:1199768-1199790 CTCCCTGCCTCCTGGGACAGAGG - Intergenic
1143514483 17:7412999-7413021 CTCCCCTCACACTGGGAGAGGGG + Intronic
1144797897 17:17904873-17904895 CACCTTTCCCTCTGGGACCATGG + Intronic
1146404841 17:32528200-32528222 CTTCTGCCCCACTGGGCCAGTGG + Intronic
1147146797 17:38490227-38490249 CTCCCTGCCTCCTGGGACAGAGG - Intronic
1148063353 17:44851536-44851558 CTCCTTTCCCAACGAGACTGGGG + Intronic
1148659867 17:49321156-49321178 CTCTTTTCCTTCTGGCACAGTGG + Intronic
1148892992 17:50821107-50821129 CTACTTTGTCACTAGGACAGAGG - Intergenic
1152769091 17:82156617-82156639 CTCCTTACCAACAGGTACAGGGG + Intronic
1152995849 18:405829-405851 CTGCTTGCCCACTGTGTCAGAGG + Intronic
1157363969 18:47046445-47046467 CTCATCTCGCACTGGAACAGAGG - Intronic
1159308554 18:66677769-66677791 AACCTTTCCCACTGGTTCAGAGG - Intergenic
1160210741 18:76876082-76876104 GTCCGTTCCCTCTTGGACAGAGG + Intronic
1161161692 19:2765278-2765300 CTCGTTTCCTACAGGGAGAGAGG + Exonic
1161604216 19:5205704-5205726 ACCCTTTCCCCCTGGGACTGTGG - Exonic
1161680472 19:5677479-5677501 CTCCTCTCTGAGTGGGACAGTGG + Intronic
1162117212 19:8438106-8438128 CTCCTTTCCCACTGAGAGGCAGG + Intronic
1162795277 19:13083869-13083891 CTCCCTACCCACTGGATCAGTGG - Intronic
1165066313 19:33230865-33230887 CTCCTATCTCACTTGGACAATGG + Intergenic
1166978905 19:46621412-46621434 CTCCTTTCCCACAGGAGCAGAGG + Exonic
1167511423 19:49897215-49897237 CTTGATTCCCACGGGGACAGAGG + Intronic
1167533269 19:50032171-50032193 CTCCTTCATCACTGTGACAGGGG + Intronic
1168011520 19:53537497-53537519 CTCCTTTCCCAGTCGGGAAGGGG + Intronic
1168719796 19:58548699-58548721 TTCCTGTCCCACTGAGGCAGAGG + Intronic
925894863 2:8463338-8463360 CTCCTTGTCTGCTGGGACAGGGG - Intergenic
927888700 2:26734664-26734686 CTCCTTCCTCACTGGGCAAGAGG - Intergenic
927899173 2:26806523-26806545 CTCCTTTCCTCCTGGCACAAGGG + Intergenic
928173377 2:29017794-29017816 CTCCTTCCCCTCCGGGGCAGCGG + Exonic
929579365 2:43071872-43071894 CTCCTTTCCCACTGGCAGAAAGG - Intergenic
929977293 2:46647212-46647234 CTTCTTTCTCACTGGGGCATGGG - Intergenic
931251209 2:60531883-60531905 CTTATTTCCCACTGGGTCTGGGG - Intronic
931307287 2:61042232-61042254 CTGCTTTTCCACTGTAACAGTGG + Intronic
934988030 2:98901281-98901303 CAACTTTCCCACTGTGGCAGAGG - Intronic
935092030 2:99904731-99904753 CTCCTTTCCCACAGGGAGAGGGG + Intronic
935333797 2:101996892-101996914 GCCCTTTCCCACTAGGGCAGGGG + Intronic
935711822 2:105905840-105905862 CTCCTGTCCCATGGGGATAGAGG + Intergenic
938250568 2:129812791-129812813 CCGCCTTCCCACTGGGACAATGG - Intergenic
940170923 2:150829407-150829429 GTCCTTCCACACTGGGTCAGAGG - Intergenic
940493366 2:154393311-154393333 TTCCTTTGCCACAGGGACTGAGG - Intronic
940517409 2:154698580-154698602 CTCCTTCTCCCCTGGGACGGAGG - Exonic
941264909 2:163348845-163348867 CTCCTTTCCCACTTGCAAGGAGG + Intergenic
941636053 2:167935938-167935960 CTGCTTTCCAGCTGGGACATCGG + Intergenic
944400502 2:199320451-199320473 CTCCTTTCCCACGAAGAAAGGGG + Intronic
944490601 2:200254426-200254448 CTCCTTACACAGTGGGACAGAGG - Intergenic
944679524 2:202064480-202064502 CTGCTTTTCCACTGGGACAGAGG - Intergenic
947149687 2:227102510-227102532 CTACTTTCCTACTGGCACTGAGG + Intronic
948530679 2:238601464-238601486 CTCCTTCCGCACTGGACCAGGGG - Intergenic
948582276 2:238996539-238996561 CTCCTAACCCCCAGGGACAGGGG - Intergenic
1172779963 20:37430736-37430758 CTTCTTTCCCCCTGGGACTTGGG + Intergenic
1173434219 20:43017772-43017794 CTCCTCTACCTCTGGGACACAGG - Intronic
1173799592 20:45886766-45886788 CTCCTTCCCCACTGCCTCAGAGG + Exonic
1174063188 20:47846529-47846551 CTCATTTCCCTCTGAGACACTGG - Intergenic
1174072538 20:47909144-47909166 CTCATTTCCCTCTGAGACACTGG + Intergenic
1174151539 20:48489563-48489585 CTCATTTCCCTCTGAGACACTGG - Intergenic
1174307537 20:49624834-49624856 TTTCTTCCCAACTGGGACAGGGG - Intergenic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
1175216599 20:57394570-57394592 CTCCCTTCCCAGGAGGACAGAGG - Intronic
1176115426 20:63429943-63429965 CTCCATCCCGACTTGGACAGCGG - Intronic
1180214640 21:46316539-46316561 CTCCTTTCCCTTAGGCACAGGGG + Intronic
1180641696 22:17304243-17304265 CTCCTGTCCTGCTGGGACAAGGG - Intergenic
1181265371 22:21628131-21628153 CACCTTCACCACTGGGGCAGTGG - Exonic
1182766351 22:32760690-32760712 GTCCTTCCCCACTGGTTCAGAGG + Intronic
1183341534 22:37284425-37284447 AACTTTTCCCACTGGGGCAGAGG + Intronic
1183544983 22:38450626-38450648 CTCCTCACTCACTGGCACAGGGG + Intronic
1183651316 22:39155512-39155534 TTCCATTCCCACGGCGACAGCGG - Intergenic
1184247178 22:43241644-43241666 CTCCTCTCCCCCTGGGACCCAGG + Intronic
1184647463 22:45903838-45903860 CTCCCGTCCCCCTGGCACAGTGG - Intergenic
950019788 3:9779246-9779268 CTCCTTTGCCACAGTGACTGAGG + Intronic
950031413 3:9856340-9856362 CTCCTTTCCAACTGAGACTGTGG - Intergenic
950491123 3:13305704-13305726 CCCCTGTCCCACTGGTGCAGCGG + Intergenic
952102963 3:30036207-30036229 TTCCTTTCCCACAGGAACTGTGG - Intergenic
952196897 3:31085301-31085323 CTCCTGTCCCACAGGGAAAGCGG + Intergenic
952898300 3:38093823-38093845 CTCCTGTCTCACTGGGACTGAGG - Intronic
954443924 3:50536488-50536510 CTCCTTGCCCCCTTGGTCAGTGG + Intergenic
955348752 3:58179264-58179286 CTCCTTTCCAAGTGGGGCAATGG - Intergenic
956524157 3:70139372-70139394 ATCCAGACCCACTGGGACAGTGG + Intergenic
956711742 3:72044272-72044294 GTCCAATCACACTGGGACAGTGG - Intergenic
957155048 3:76535802-76535824 CTCCTTTTCAATTGGTACAGGGG - Intronic
958860693 3:99441965-99441987 CTCCTTTCAGATTGGGACTGAGG + Intergenic
962124869 3:132606650-132606672 CTCCCATCTCCCTGGGACAGAGG + Intronic
962688076 3:137866681-137866703 TTCCCTACCCACTGGGCCAGTGG + Intergenic
963502578 3:146146714-146146736 CTGATTCCCCGCTGGGACAGAGG + Intronic
964250923 3:154716096-154716118 TTCCTTTACCAGTGGTACAGAGG - Intergenic
967084243 3:186079748-186079770 ATCCTTTCTCACTGGGAGAGGGG - Intronic
967219370 3:187236064-187236086 CTCCAATCCCAATGTGACAGTGG - Exonic
967347730 3:188477034-188477056 TTGCTCTCCCTCTGGGACAGAGG + Intronic
969307133 4:6332304-6332326 TGCCATTCCCACAGGGACAGAGG + Intronic
969553618 4:7890829-7890851 CTGCCTTCCCACCGGGAAAGTGG - Intronic
969724522 4:8911364-8911386 CTCCTTTCTCCCTGTCACAGCGG - Intergenic
971225760 4:24750233-24750255 CTGCCTTCCAACTGGGACATTGG - Intergenic
973644262 4:52934225-52934247 TTTTTTTCCCACTGGGAGAGAGG - Intronic
975735570 4:77377554-77377576 CTCCTTTACCACTGGGACTCGGG - Intronic
975890801 4:79024623-79024645 CTCCTTTCCCACTTGTAAATGGG + Intergenic
977061004 4:92256727-92256749 ATCCCTTCCCACTGGCAGAGTGG - Intergenic
978035330 4:103986081-103986103 TTCCATGCCCACTGGGACAGAGG + Intergenic
978165433 4:105601544-105601566 CTCATTTCCCACTGGGAGCTTGG + Intronic
979653476 4:123163669-123163691 CTCCCTTCCCTCAGGGACTGTGG - Intronic
980644077 4:135619131-135619153 AACCTTTCCAACTAGGACAGTGG + Intergenic
981364746 4:143889373-143889395 CTCCTTTCCCACTGGGACAGTGG - Intronic
981375246 4:144007644-144007666 CTCCTTTCCCACTGGGACAGTGG - Intronic
981385862 4:144129845-144129867 CTCCTTTCCCACTGGGACAGTGG - Intronic
981449734 4:144882728-144882750 CACCTTTCCCAATGGGACTGAGG + Intergenic
984583511 4:181536537-181536559 CTCCTTGCCATCTGGGACACAGG + Intergenic
984608590 4:181812878-181812900 CTCCTTTCCCCGGGAGACAGGGG - Intergenic
984835213 4:184013102-184013124 CTCCTTTCCCTCTGGGCCCCTGG + Intronic
985308586 4:188572846-188572868 TTCCTTTCCCTCTAGGAAAGAGG + Intergenic
986378791 5:7162423-7162445 CTCCCATCTCCCTGGGACAGAGG - Intergenic
986443993 5:7805532-7805554 CTCCTTTCCCCTCAGGACAGTGG + Intronic
986715482 5:10520668-10520690 CTCCCTCCCTACTGGGGCAGTGG + Intronic
988771813 5:34440126-34440148 CTCCTTTCCCGAGGAGACAGAGG + Intergenic
990784860 5:59408135-59408157 CTCCTGTACCACTGGGACTGTGG - Intronic
992020344 5:72617810-72617832 CTCCTTTCCTCTTGGGAAAGAGG - Intergenic
994991271 5:106999877-106999899 CTCCTATCTCCCTGGGACAGAGG - Intergenic
996201997 5:120686567-120686589 CTCCTTTCCCACTAGAAAATGGG + Exonic
996478786 5:123949879-123949901 CATTTTTCCCACTGGGACTGGGG - Intergenic
997522606 5:134532820-134532842 CTCATTAGCCACTGTGACAGTGG + Intronic
998036997 5:138925917-138925939 CTCCTCTGCCCCTGCGACAGAGG - Intronic
999113558 5:149142125-149142147 CTCCTTTGCCATGGGAACAGGGG + Intronic
999666326 5:153917052-153917074 CTGCTTTGTCCCTGGGACAGAGG - Intergenic
1000509689 5:162165524-162165546 CTAATTTCTCTCTGGGACAGAGG + Intergenic
1000826302 5:166048658-166048680 CTCATTTTCTACAGGGACAGAGG - Intergenic
1001273938 5:170336640-170336662 CTGCTTTCCCAATGGAGCAGAGG - Intergenic
1001483698 5:172105231-172105253 CTCCTCTCCCTCTGGGCCACTGG + Intronic
1001607300 5:172970753-172970775 TTTTTTTCCCACAGGGACAGAGG - Intergenic
1001775365 5:174325542-174325564 CTGCTTTCTAATTGGGACAGCGG + Intergenic
1002714235 5:181216503-181216525 CTCCTTGGCCACTGGGACTCTGG - Intergenic
1003191370 6:3878174-3878196 CTCCTGTACCAATGGCACAGAGG - Intergenic
1005243207 6:23854740-23854762 CTGCTTTCCCATTGCTACAGGGG - Intergenic
1005454290 6:26004236-26004258 GTCCTGTCTCACCGGGACAGAGG - Intergenic
1006153910 6:32003939-32003961 GGCCTTTCCCACTGTGGCAGAGG + Intergenic
1006160218 6:32036676-32036698 GGCCTTTCCCACTGTGGCAGAGG + Intergenic
1006414148 6:33893368-33893390 CTCCTCTCCCTCTGGGACCAAGG - Intergenic
1007347275 6:41241420-41241442 CTCCTTTGCTTCTGGGACACTGG - Intergenic
1008562053 6:52733317-52733339 CTCCTCCCACACTGGGACAGAGG - Intergenic
1008622022 6:53280037-53280059 CACCTTTCCCTTTGGGACTGAGG + Intronic
1008944506 6:57083045-57083067 CTCCTCTTCCATTGGGACAGAGG - Intergenic
1009338890 6:62529220-62529242 CTCCATTCCCATTGTGACAGAGG - Intergenic
1011318655 6:86065407-86065429 CTCCCATCTCCCTGGGACAGAGG - Intergenic
1013463208 6:110395285-110395307 CTGCCTTCCAACTGGGACATTGG + Intronic
1016542201 6:145178466-145178488 CTCCCGTCTCCCTGGGACAGAGG + Intergenic
1016811004 6:148261390-148261412 CTCCTTTCTCATAGGGAGAGAGG - Intergenic
1016816372 6:148306729-148306751 CTCCTTTCCCCCTGAGAAAGAGG + Intronic
1016941439 6:149485620-149485642 CTTCTCTCCCACTGTGGCAGGGG + Intergenic
1017570799 6:155742278-155742300 CTCCTTTCTCACAGGATCAGAGG + Intergenic
1017897980 6:158698027-158698049 CTTCTTTCATCCTGGGACAGTGG + Intronic
1019705176 7:2494188-2494210 CCCCTTCCCCACTGGGACTGGGG - Intergenic
1019737360 7:2657175-2657197 CTCCTCTCCCACTTGGACTGTGG + Intronic
1020201238 7:6081591-6081613 CTCCTTTCCGACTGGGCAGGCGG + Intergenic
1020884389 7:13803927-13803949 CTCCCATCTCCCTGGGACAGAGG + Intergenic
1021442266 7:20689782-20689804 CTCCTTTACCAGTGGGCAAGAGG - Intronic
1021545396 7:21807551-21807573 TTCCATTCCCAGAGGGACAGGGG + Intronic
1024303427 7:47905398-47905420 CTACTTTCCCACTTGGTCATGGG + Intronic
1024964168 7:55006698-55006720 CTCCTGTCACTCTGGGGCAGAGG - Intergenic
1025231214 7:57204380-57204402 CTCATTTCCCTCTGAGACACTGG + Intergenic
1026159728 7:67858155-67858177 CTTCTTTCCCACTGGTTCCGGGG - Intergenic
1026819836 7:73539707-73539729 CTCCCTTCCCTCTGTGAAAGGGG + Intronic
1027864531 7:83629411-83629433 CTCCCATCTCCCTGGGACAGAGG - Intronic
1029457983 7:100680556-100680578 CTCCTCTCCCATTTGGTCAGCGG + Exonic
1031488835 7:122363281-122363303 CTCATTTGCCACGAGGACAGCGG + Intronic
1031973204 7:128078276-128078298 CTCCATCCCCACAGGGAAAGAGG + Intronic
1031983759 7:128148790-128148812 TTCCTATCCCACTGGGGTAGGGG + Intergenic
1032260418 7:130331630-130331652 ATCCTTTCCCACCGGGCCTGGGG - Intergenic
1032852243 7:135805062-135805084 CTACTTTCCCAGTGGGTAAGAGG - Intergenic
1035179541 7:157079179-157079201 GTCATTTCCCGCAGGGACAGTGG - Intergenic
1036756041 8:11471758-11471780 CTCCTTTCCACCTGGGACCTAGG + Intronic
1037217052 8:16467774-16467796 GTCTTTTCCTACTGGAACAGTGG + Intronic
1037971714 8:23176721-23176743 CTCCCTTCCCTCTGGGGAAGGGG + Intergenic
1038039543 8:23712709-23712731 GTCCTTTAACACTGGGAAAGTGG + Intergenic
1039376480 8:37039544-37039566 CTACTTTCTCACTGGAAAAGCGG + Intergenic
1043497448 8:80817851-80817873 CTCCCTTCCCATTAGGACTGGGG - Intronic
1045037093 8:98184307-98184329 CTCATTTTCCACTGAAACAGGGG - Intergenic
1047185066 8:122625514-122625536 CTCCTTTCTCAGTGGTCCAGAGG - Intergenic
1048032493 8:130645878-130645900 CTCCTCTGCTACTGAGACAGAGG - Intergenic
1048036538 8:130682713-130682735 CTCCTTTCCCACAGCCACAAAGG - Intergenic
1049365142 8:142233446-142233468 CTCCTTTCCCTCTGACACTGAGG - Intronic
1049502721 8:142976025-142976047 CTCCCATCCCACTGGGGCAGTGG - Intergenic
1050670715 9:7993833-7993855 CTCCTGTCTCCCTGGCACAGTGG + Intergenic
1051175112 9:14352823-14352845 AGCCTTTCCCTCTGGAACAGAGG + Intronic
1051896739 9:21995592-21995614 CTCCTTTCCAGCTGGGAGACAGG + Intronic
1055622929 9:78144779-78144801 TTCCTTTCACCCTGGGACACAGG + Intergenic
1057182839 9:93039158-93039180 CTCCTTTCCCCCTGGGGCCTTGG + Intergenic
1057603033 9:96475521-96475543 CTATTCTCACACTGGGACAGAGG + Intronic
1057738345 9:97688636-97688658 CTCATTTCCCACCGACACAGTGG - Intronic
1058919973 9:109604025-109604047 CTCCCTTCCCACTGGGAAGTGGG - Intergenic
1059703091 9:116794912-116794934 CTCCTTTCCTATTGGGCAAGTGG + Intronic
1060641479 9:125242211-125242233 ATCCTTTCCCTCTGGGGCAAAGG + Intergenic
1061973471 9:134056760-134056782 CTCCCTCCCCACTGGGACTCTGG - Intronic
1185488992 X:505008-505030 TTTCTTTCCCACAGGGAAAGGGG + Intergenic
1189552732 X:42110407-42110429 CTCCCATCCCCCTGGGGCAGGGG + Intergenic
1190540355 X:51471208-51471230 CTCCTTCCCTCCTGGTACAGTGG + Intergenic
1191795696 X:65019055-65019077 CCCCCATCTCACTGGGACAGAGG + Intronic
1193878771 X:86896374-86896396 CTCCCATCTCCCTGGGACAGAGG + Intergenic
1199635162 X:149806723-149806745 GTCCTTTCCTTCTGGGCCAGGGG - Intergenic
1199659324 X:150032400-150032422 TTAGTTTCCCACTGGGATAGTGG - Intergenic
1199799924 X:151240419-151240441 CTCCTTTCCCTTAGGGACTGGGG + Intergenic