ID: 981385863

View in Genome Browser
Species Human (GRCh38)
Location 4:144129852-144129874
Sequence CTCTGCTCTCCTTTCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 3, 1: 1, 2: 6, 3: 51, 4: 428}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981385863_981385866 5 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385866 4:144129880-144129902 TTCCTGGCTTTGCCACCAAATGG 0: 2
1: 1
2: 4
3: 37
4: 307
981385863_981385868 9 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data
981385863_981385871 12 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385871 4:144129887-144129909 CTTTGCCACCAAATGGTTGGGGG 0: 2
1: 1
2: 0
3: 12
4: 112
981385863_981385869 10 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385869 4:144129885-144129907 GGCTTTGCCACCAAATGGTTGGG 0: 2
1: 1
2: 1
3: 11
4: 109
981385863_981385870 11 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385870 4:144129886-144129908 GCTTTGCCACCAAATGGTTGGGG 0: 2
1: 1
2: 2
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981385863 Original CRISPR CTCTGCTCTCCTTTCCCACT GGG (reversed) Intronic
900732141 1:4269066-4269088 CTCTCCTCTCCCTGACCACTGGG - Intergenic
901637121 1:10675658-10675680 CTCTGGGCTCCTCTCCCAGTTGG + Intronic
903003587 1:20283766-20283788 CCCTGCCCTCATTTCCCTCTGGG - Intergenic
903780207 1:25815944-25815966 CTCGGCTCTCCCTACCCATTTGG + Exonic
905182360 1:36175204-36175226 CTCTGTTCTCCTCTCCTACAGGG - Intronic
905544355 1:38785992-38786014 CTTTCCTCTCCATTCCCATTGGG - Intergenic
907261339 1:53220711-53220733 CGCTGCTCGCCTGGCCCACTGGG + Intergenic
907443102 1:54490464-54490486 CTCTCCTCTCCTTCCCTTCTAGG + Intergenic
908267499 1:62393850-62393872 CTCTGCTCTACTTTCTCAGCTGG + Intergenic
908437868 1:64124440-64124462 CTATTCTCTCCTTTCCTTCTAGG + Intronic
908934924 1:69363278-69363300 CTCTCTTTTCCTTTCCAACTTGG - Intergenic
909041345 1:70655840-70655862 CTGTGCTCTCATTACACACTAGG + Intergenic
910757415 1:90707561-90707583 CTCTCCTCTCCTTGTCCACTGGG - Intergenic
911252350 1:95591540-95591562 CCTTTCTCTCTTTTCCCACTAGG - Intergenic
912441726 1:109704136-109704158 CACAGCTTTCCTCTCCCACTCGG + Intronic
912453712 1:109783818-109783840 CACAGCTCTCCTGCCCCACTGGG + Intergenic
912737788 1:112165550-112165572 CTCTGCTTTCCCCTCCCACCTGG + Intergenic
912994826 1:114522268-114522290 CTCAGTCCTCCTTTGCCACTGGG - Intergenic
913212722 1:116594962-116594984 TTCTGCTCTCCTTTGTCCCTAGG + Intronic
914250387 1:145917594-145917616 CTCTGTTCTTCTTTCTCATTTGG - Intronic
914993002 1:152514819-152514841 CACAACTCTCCTTTCCCACATGG + Intronic
915081441 1:153355407-153355429 ATCTGGTCTACTTTCCCACGTGG + Intergenic
915110479 1:153561681-153561703 CCCAGCTCTCCCTCCCCACTGGG + Intronic
915735889 1:158084625-158084647 CTCACCTCTCCTTTCCCACAGGG + Intronic
915918222 1:159954026-159954048 CTCTGTTCCCCTGCCCCACTGGG - Intronic
916320788 1:163501446-163501468 CTCTGTGCTCCTTTTCAACTAGG + Intergenic
916474770 1:165158714-165158736 CTCAGCTCCCCTTTCCCTCAGGG + Intergenic
917185450 1:172349113-172349135 CTCTAGGCTTCTTTCCCACTTGG + Intronic
918114690 1:181485733-181485755 CTGGGCCCTCCTTTCTCACTCGG + Intronic
918704114 1:187639748-187639770 CTCTGCCCTACTTCCCAACTTGG + Intergenic
919907192 1:202086109-202086131 CTTTGCTCCCCTTTCCTGCTTGG + Intergenic
920933803 1:210412625-210412647 CTCTGCCCTCCAGGCCCACTAGG + Intronic
922356624 1:224782625-224782647 CTCTGCTCCCCGAGCCCACTTGG + Intergenic
922887802 1:229033263-229033285 GTCTGCTTTCCTTTGCCACTGGG - Intergenic
923157575 1:231292130-231292152 CTCTTCTCTCGTTACCAACTAGG + Intergenic
924508603 1:244710052-244710074 CTCTTCTCTCCTTCCCCTCTTGG - Intergenic
1065106342 10:22390405-22390427 TGCTGCTGGCCTTTCCCACTTGG + Intronic
1066596405 10:37054974-37054996 CACTGCTGCCCTTTCCCACAAGG - Intergenic
1067038443 10:42935502-42935524 CTACACTCTCCTTTCCCCCTTGG + Intergenic
1068888884 10:62127586-62127608 CTCAGCTCTCCTTCTCCAGTAGG - Intergenic
1068958493 10:62843460-62843482 CTTGGCTCTCTTTTCCCACCAGG - Intronic
1069237491 10:66095303-66095325 CTCTGCTCTCCTATCTTTCTGGG - Intronic
1069408323 10:68126308-68126330 CTCTACTCTCCTTTCCAGTTTGG - Intronic
1071486966 10:86108643-86108665 CTCTGCTCTGCTTTTCTCCTTGG + Intronic
1071884052 10:89930405-89930427 CTCTGCTCTCCAACCCCTCTTGG - Intergenic
1071903621 10:90147694-90147716 CTTTGCTCTCCTGTTCCACTGGG - Intergenic
1072507470 10:96083027-96083049 GTCTTCTCTGCTTCCCCACTTGG - Intergenic
1072686854 10:97542624-97542646 CCCTGCTCTCCTTCCCAACAGGG - Intronic
1072757166 10:98029336-98029358 CTCTTCCCTTCTTTTCCACTTGG + Intronic
1073005403 10:100320002-100320024 CCTGGCTCTCCCTTCCCACTGGG - Intronic
1073062206 10:100739653-100739675 CCCTGCTCTCCGTTCCCTTTCGG + Intronic
1073069468 10:100784038-100784060 CTCTCCTCTCCCTTCCCACCAGG - Intronic
1073080777 10:100859334-100859356 CTCTCCTCTCCTCTCCTTCTGGG + Intergenic
1073423361 10:103441692-103441714 CTCTCCTCTCCTCTCCTCCTAGG - Intronic
1074547549 10:114412964-114412986 CTCTGCTGACCTATCTCACTGGG + Intergenic
1075082147 10:119391326-119391348 CACTGCTCGCCATTCTCACTGGG + Intronic
1075262838 10:120977848-120977870 CCCTTCTCTCCTCTCGCACTTGG + Intergenic
1075482550 10:122795108-122795130 CCCTCCTGTCCTTTCCTACTGGG - Intergenic
1075984084 10:126768201-126768223 CTCTGCTATCCTTTCTCGGTTGG - Intergenic
1076703787 10:132290160-132290182 CCCTGCTCTCCTTTCTGGCTGGG - Intronic
1077019119 11:409715-409737 CCCTGCTCACCCCTCCCACTGGG - Intronic
1078047646 11:7931533-7931555 CTCTGCTCTCACCTCCTACTGGG - Intergenic
1078059719 11:8035425-8035447 CACTGCTCTCACTTCCCGCTGGG + Intronic
1078330526 11:10415495-10415517 AACTGCTGTCCTTGCCCACTTGG - Intronic
1079724455 11:23863691-23863713 CCCTGCTCTCCCTTCCCAACTGG + Intergenic
1080332402 11:31154348-31154370 CTCTGCTCTGGTTTCCCTCCAGG + Intronic
1081513546 11:43801401-43801423 CTCTTCTCTGTCTTCCCACTTGG - Intronic
1081660075 11:44882664-44882686 CTCTGCTCTCTCTTCCCTCTTGG - Intronic
1081989585 11:47330601-47330623 CTCTGCTCTCACTTCCCCCATGG - Intergenic
1082940942 11:58704385-58704407 CTCTTGTCTCCTGTACCACTGGG - Intronic
1083160237 11:60850035-60850057 CTCTGCCCTTCTGCCCCACTTGG + Intronic
1084080202 11:66818055-66818077 CTCTGTTCTCCTTTCTCTATGGG + Intronic
1084223556 11:67700064-67700086 CTCAGCTTTCCTCTCCCACTCGG + Intergenic
1084394692 11:68901600-68901622 TTCTCCTCTCCTCTCCCATTTGG + Intronic
1085480584 11:76819693-76819715 CTCTCTTTTCCTTTCCAACTTGG - Intergenic
1085704054 11:78770192-78770214 ATGTGTTCTACTTTCCCACTTGG - Intronic
1087115048 11:94515677-94515699 CTCTCCTCTCCTTTCCTTCCTGG + Intergenic
1087525842 11:99311252-99311274 ATCTGGTATTCTTTCCCACTGGG + Intronic
1088277343 11:108101749-108101771 CTCTGCTCTCTTTTCCTCTTAGG + Intronic
1089011033 11:115131985-115132007 CTCTGGTCTAGTTTCCCCCTGGG + Intergenic
1089781000 11:120873206-120873228 CTCTGCCCTCCTCTCCTTCTAGG + Intronic
1090184140 11:124725307-124725329 CACTCCTCTCCATTCCCCCTGGG - Intergenic
1090672629 11:128959781-128959803 CTCTGCTCTCCTTCCAGACAGGG + Intergenic
1091129467 11:133133487-133133509 CTCTCCTCTCCTTGCCCCCTGGG + Intronic
1092318675 12:7447358-7447380 CTCTGCCCTCCAGGCCCACTGGG - Intronic
1092776046 12:11946061-11946083 CTCTCCTATCCTTTCACACCTGG - Intergenic
1093480792 12:19601853-19601875 CTCTGCCCTCCAGGCCCACTGGG - Intronic
1094167714 12:27459683-27459705 GTCAGCTCTCCTATCCCAATGGG + Intergenic
1096473933 12:51896572-51896594 CTCCTCTCTCCTTTCCCACAGGG + Intergenic
1096477204 12:51915554-51915576 CTCTCCTCTCCTTTGCCTGTGGG + Intronic
1096504052 12:52081725-52081747 CTCTCCTCTCCTTTCCCAGCTGG + Intergenic
1096787814 12:54027724-54027746 ATCTGCTCTCCTTTGCCTCCTGG - Intronic
1097191128 12:57220172-57220194 CCCTGCTCCCCATCCCCACTGGG - Intronic
1097196015 12:57242885-57242907 GTCTGCCCTCCGTTCTCACTCGG + Intergenic
1097706463 12:62873948-62873970 CCCTCCTCTCCTTCCTCACTTGG - Intronic
1097864561 12:64549002-64549024 CTTCCCTTTCCTTTCCCACTTGG - Intergenic
1097864681 12:64550139-64550161 CTCTTTTCTCTTTTCCTACTGGG + Intergenic
1098108577 12:67097241-67097263 ATCTTCTCTCCTTTTCCTCTGGG + Intergenic
1098230778 12:68370125-68370147 CTTTGCCTTCCCTTCCCACTGGG - Intergenic
1103000905 12:117384727-117384749 CTCTGCCCTCATCTCCCAGTTGG - Intronic
1103347932 12:120263930-120263952 CTTTGCTCCCAGTTCCCACTGGG + Intronic
1103576495 12:121881377-121881399 CTCTCCTCTCCTTTCCTGCCAGG - Intergenic
1103636096 12:122306670-122306692 TTCTTGTCTCCTTTCTCACTTGG - Intronic
1104258493 12:127161106-127161128 CTCTCCTTTCCTTTCCAACCCGG - Intergenic
1104363852 12:128158873-128158895 CTCTTCTTTTCTTCCCCACTGGG - Intergenic
1107790568 13:43998156-43998178 ATCTGCTCTCCATTCCCCCAGGG - Intergenic
1108294430 13:48999222-48999244 CTCTGCTTTCCATATCCACTGGG - Intronic
1108493032 13:51000134-51000156 CTTTGCTGACCTTTCCCCCTTGG - Intergenic
1108789142 13:53945614-53945636 CTCTCATCTCCTTAGCCACTTGG + Intergenic
1108898338 13:55364062-55364084 CTCTGCCCTCCTTTCTCAATGGG - Intergenic
1109746342 13:66627866-66627888 CTCTGCTATCTTTTTCCATTTGG + Intronic
1111482892 13:88855267-88855289 CTCTACTCTCCAGGCCCACTGGG - Intergenic
1111547020 13:89751874-89751896 CTGTGCTCTCATTTTTCACTGGG - Intergenic
1114402608 14:22423553-22423575 CTCCTCTCTTCTGTCCCACTGGG - Intergenic
1114646830 14:24260636-24260658 CACTGCCCCCCTTGCCCACTGGG + Exonic
1114689601 14:24568091-24568113 CTCTGATCTCTTTTCCTCCTTGG - Intergenic
1115622543 14:35154165-35154187 CTCTCATCTCTGTTCCCACTAGG - Intronic
1115828381 14:37304293-37304315 CTCTGCTTTTCTTTACCCCTTGG + Intronic
1116553349 14:46270919-46270941 CTATGCTCTCCTCACACACTGGG + Intergenic
1116644522 14:47509631-47509653 CTCTGCTTTCCAGGCCCACTGGG - Intronic
1117096633 14:52305183-52305205 CTCTTGTCTCATTTCCCACCAGG - Intergenic
1117586716 14:57214589-57214611 CTATGCTCTCATTTCTCAGTTGG - Intronic
1117911752 14:60643334-60643356 CTCTGCTCGCCTTGACCTCTTGG - Intergenic
1118904282 14:70012200-70012222 CTCTGCTTTCAGTTCTCACTTGG - Intronic
1118986106 14:70756203-70756225 TTGTGCTTTCCCTTCCCACTGGG + Intronic
1119279453 14:73392176-73392198 CTCTGTTTTCCTTTGCCTCTTGG - Intronic
1120847433 14:89138841-89138863 CTCTGCTCTCCTGGCCCACCTGG + Intronic
1121065606 14:90961398-90961420 CTCTTTTCCCCTTTCCAACTTGG + Intronic
1121391235 14:93576774-93576796 CTCCCCTCTCCCTGCCCACTTGG - Intronic
1121832930 14:97067355-97067377 CACTGCTCTCCTGTCCCACCGGG - Intergenic
1121867211 14:97373817-97373839 CTCTTCTAGCCTTTCCCACTAGG + Intergenic
1122673119 14:103386973-103386995 CTCTGTTCTCCTCTAACACTGGG + Intronic
1202918419 14_KI270723v1_random:6176-6198 CTCTGCCCTCCTTCTCCGCTGGG - Intergenic
1123992255 15:25692387-25692409 CTCTGCTGTCCTTTCCCCGAAGG - Intronic
1124395295 15:29295319-29295341 CCCTGCACCTCTTTCCCACTTGG + Intronic
1124420451 15:29516577-29516599 CTTTGCTCTCATTTCCCAGCAGG - Intronic
1124448776 15:29765332-29765354 CTTTGATCTGCTTTACCACTTGG - Intronic
1125211595 15:37222503-37222525 CTCTGCTCTCCTTTCTCGTTTGG - Intergenic
1126817220 15:52465995-52466017 CTGTGGTCCACTTTCCCACTAGG + Intronic
1127192306 15:56543401-56543423 CTCCTCTTTCCTTTCCCTCTTGG - Intergenic
1127363126 15:58262466-58262488 TTCTGCATTTCTTTCCCACTCGG + Intronic
1129615868 15:77098400-77098422 CTCTGCCCTTCTGTGCCACTGGG - Intergenic
1129893671 15:79088837-79088859 CTTTGCTCTTCTTTCCATCTGGG + Intronic
1130170791 15:81511058-81511080 CTCTGGTCTCTTTTCACATTTGG - Intergenic
1130203536 15:81854862-81854884 CTCTCCTCTCCTTTCCACTTGGG + Intergenic
1130420921 15:83746148-83746170 CTCTTCTCTCCTTTCTTCCTTGG - Intronic
1131086280 15:89578067-89578089 CACTGCTCCCCTTGCCTACTAGG - Intronic
1131398816 15:92108405-92108427 CTCTCCTCCCCTTTCCTACATGG + Intronic
1132672755 16:1108427-1108449 CTCTGCTCTCCCTTCCCCCATGG - Intergenic
1132993472 16:2810217-2810239 CACTGATTTCCTTTTCCACTGGG + Intergenic
1133442305 16:5831048-5831070 ATCTGTTCTCCTTACCCACAGGG + Intergenic
1133888583 16:9855749-9855771 TTCTGCTGTCCTTTCACCCTGGG - Intronic
1134741722 16:16553428-16553450 CCCTCCTCTCCTTTCTCTCTCGG + Intergenic
1134925844 16:18159030-18159052 CCCTCCTCTCCTTTCTCTCTCGG - Intergenic
1135564142 16:23498977-23498999 CTCTGCTCTTCTCTCCCTCCAGG - Intronic
1135977309 16:27117180-27117202 ATCTGCCCCCATTTCCCACTAGG + Intergenic
1137947988 16:52752573-52752595 CTCTTTTGTCCTTTCCAACTCGG - Intergenic
1138113137 16:54340247-54340269 CTCAGCTCTCCCAGCCCACTGGG + Intergenic
1139313758 16:66050172-66050194 CTCTTCTCCCTTTTCCCACTTGG - Intergenic
1139355136 16:66363127-66363149 CCCTCCTCTCCTTTCCCACCGGG - Intergenic
1139450433 16:67024793-67024815 CTCTGCTTTCCTTTCCCTATGGG + Intergenic
1139599097 16:67975983-67976005 CCCTGCTCTCCTCTCTCACCTGG + Exonic
1139776508 16:69320048-69320070 CTCTTCTCACCCTTCCCACAGGG - Intronic
1140567554 16:76061730-76061752 CTCTGCTCTTCTTTTCTCCTTGG + Intergenic
1140946124 16:79770038-79770060 CTCAGCTCTCTTTTCCTCCTGGG + Intergenic
1141428253 16:83957345-83957367 CTCTACTCTCCCATCTCACTGGG - Intronic
1141444776 16:84050796-84050818 TGCTGCTCTCCTTACCCACATGG - Intergenic
1141894574 16:86950624-86950646 CTCTGCTCTCATGTCCTGCTGGG + Intergenic
1142088193 16:88195726-88195748 CTCTGTTCTCCTTTGCATCTCGG - Intergenic
1142308869 16:89300484-89300506 CTCTGCTCTCTCTGCCCGCTCGG + Intronic
1142847202 17:2687699-2687721 CTATGATCTTCATTCCCACTTGG + Intergenic
1143437523 17:6940182-6940204 CTCTCTTTTCCTTTCCAACTCGG - Intronic
1143482387 17:7235136-7235158 TTCTGCTTTCCTTCCTCACTTGG + Exonic
1144225754 17:13144080-13144102 GTCTTCTCTCCTTTTCTACTGGG + Intergenic
1145009792 17:19361559-19361581 CTCTCCTGTCCTTTCCTATTAGG - Intronic
1146120084 17:30185207-30185229 TCCTTCTCTCCTTTCTCACTGGG - Exonic
1146226056 17:31067161-31067183 CTTTGCTCTGGTCTCCCACTTGG + Intergenic
1146629171 17:34457906-34457928 CTGAGCTCCCCTTTCCCCCTGGG + Intergenic
1146993271 17:37295264-37295286 CTCTCTTTTCCTTTCCAACTTGG - Intronic
1148565492 17:48630700-48630722 ATCTTGTGTCCTTTCCCACTGGG - Intronic
1148577257 17:48720610-48720632 ATATGCTCTCCCTTCCCACCAGG - Intergenic
1149381669 17:56100629-56100651 CTCTGATCTCCTCTCTCACTAGG - Intergenic
1149423827 17:56535724-56535746 CTCTCCTCTCCCTCTCCACTTGG - Intergenic
1149520284 17:57313605-57313627 CCCTACTCTTGTTTCCCACTAGG - Intronic
1149553611 17:57557698-57557720 CTCTGCTCCCCATTCCCACTGGG - Intronic
1149556930 17:57580101-57580123 GTCTCCTCTCTGTTCCCACTTGG + Intronic
1150250911 17:63704047-63704069 CTCTCCTCCCCTTTCCCTCCAGG - Exonic
1151814656 17:76465775-76465797 GTCTCCTCTCCTGTCCCACAAGG + Intronic
1152121227 17:78419947-78419969 TTCTGCTCTCCCTTCCCAGGGGG + Intronic
1152427176 17:80224749-80224771 CTCCGCTCTCCACTCTCACTGGG - Intronic
1152621785 17:81368534-81368556 CTCTGCTCTCTGTGCCCAGTGGG + Intergenic
1152729535 17:81962659-81962681 CTCTGCTCTCCTGCCCCACGTGG - Intergenic
1203173529 17_GL000205v2_random:174307-174329 CTGTGCTCTCCTTTCTACCTGGG + Intergenic
1153849123 18:9077053-9077075 CTCTGCACTGATTTCCCACGCGG - Intergenic
1154121696 18:11657610-11657632 GCCTGCTCTCCTTTGCCCCTGGG + Intergenic
1155189047 18:23413414-23413436 CACTGCTCTCCTTCCCCACCAGG + Intronic
1155370785 18:25098031-25098053 CTCTCCTCTCCCTACCCACCTGG - Intronic
1157562646 18:48659671-48659693 CTCACCTCTCCTTTGCCACAAGG - Intronic
1157632639 18:49114038-49114060 CCCTGCTCTCCCTTCCTCCTAGG + Intronic
1158911225 18:62064850-62064872 CTCTTCTCTCCTCTCCCTCTGGG - Intronic
1159966536 18:74600641-74600663 CTCTGGTCGCCATTCCCTCTTGG - Intronic
1160153335 18:76412274-76412296 CGATGCTCTCCTTCCTCACTGGG + Intronic
1160374037 18:78397452-78397474 CTGTGCTGTCCTTTCCCAAAGGG - Intergenic
1160539477 18:79612644-79612666 CTCTGCTCACCCTGCCCACGTGG + Intergenic
1161138665 19:2635469-2635491 CTCTTCTCTCCCTCCTCACTCGG + Intronic
1161424515 19:4195498-4195520 CTCTTCTCTCCTTCCACCCTTGG - Intronic
1161466236 19:4432181-4432203 CTCGTCTCTCCTCTCCCGCTTGG - Exonic
1161786145 19:6326969-6326991 TCCTGCTATCCTTCCCCACTTGG + Intronic
1162098794 19:8327147-8327169 CTCAGCTCTCCTTCCTCACTAGG - Intronic
1162323263 19:9982805-9982827 CTCTACTCTCCCTTCCCATCTGG + Intronic
1162802487 19:13118835-13118857 CTCTCCTCTCCTCCCCCACTCGG - Intronic
1163889317 19:19996922-19996944 CTGTGCTCTCCTTCTCCACATGG + Intergenic
1163942510 19:20508206-20508228 CTCAGCTTTCCTCTCCCACTCGG - Intergenic
1164591097 19:29507392-29507414 CCCTGCTCGCCTGTCTCACTGGG - Intergenic
1164753583 19:30673374-30673396 CTCTGCTCTCCTCTCCCTGGGGG + Intronic
1165066311 19:33230858-33230880 CCCTGTTCTCCTATCTCACTTGG + Intergenic
1166072437 19:40395013-40395035 CTCTGCCCTCCCTTCCTCCTGGG + Exonic
925047565 2:785386-785408 CTCTCATCTCCTTTCCAACCTGG + Intergenic
925377753 2:3400429-3400451 CGCTGCTTCCCTTTCCCCCTGGG + Intronic
926121467 2:10243389-10243411 CTGAGCTCGCCTTTCCCACCAGG - Intergenic
926309065 2:11661485-11661507 CTCTGCTCTCCTGTGCCTTTTGG + Intronic
926867911 2:17379937-17379959 CTCAGTTCTCCTTTCCCTTTGGG - Intergenic
927058956 2:19395787-19395809 CTCTGCAATTATTTCCCACTTGG + Intergenic
927908554 2:26880220-26880242 CTCTGTTTTCCTTTCCCTCCAGG + Intronic
928368664 2:30722967-30722989 TTCTCTTCTCCTTTCCCACAGGG + Exonic
928615433 2:33033999-33034021 ATCTGCTCTCCTGTCCCCCAGGG - Intronic
928796793 2:35033159-35033181 CTCTGCCCCTCTTACCCACTGGG - Intergenic
930622761 2:53661329-53661351 CTCTTCTTTCCTTTACCAATAGG + Intronic
930883723 2:56300446-56300468 CTCTCCACTTCTTTCCCAATAGG + Intronic
931190642 2:59996839-59996861 ATCTGTTCTCATTTCCTACTGGG + Intergenic
932097303 2:68862849-68862871 CTCTGCACTCCCTTTCCACAGGG + Intergenic
933678565 2:85078767-85078789 CTCTGCTCTCCTTCCCCTCCAGG - Intergenic
935217321 2:100984600-100984622 CTCTGATAACTTTTCCCACTTGG + Intronic
935256004 2:101310135-101310157 ATCTCCTCTCCTTTCCCATCAGG + Intergenic
937774857 2:125764167-125764189 CTGTGCTCTTCTTTCCCATATGG - Intergenic
940260783 2:151777432-151777454 CTCTGCTCTCCTGTCTCTTTGGG + Intergenic
940283221 2:152008671-152008693 CTCTTCTCTCATCTCCCACCTGG + Intronic
940568795 2:155404389-155404411 CTCTCTTTTCCTTTCCAACTTGG + Intergenic
941421510 2:165287698-165287720 CTCTGCTCCCCTTGCCCACTGGG + Intronic
941577135 2:167247355-167247377 ATCTGCTCCCCCTTGCCACTTGG - Exonic
942069869 2:172306586-172306608 CTCTGGTCTCCTCTTCCTCTCGG + Intergenic
942530568 2:176905352-176905374 CTCTGCTCTTCCTTCACTCTGGG + Intergenic
944512579 2:200479223-200479245 CTTAGCTCTCCTTTCCTCCTTGG + Exonic
944523321 2:200593531-200593553 CTGTGCTCTCTTTTCCTAATGGG - Intronic
944857784 2:203785024-203785046 CTCGGGTCTCCTTCCACACTGGG - Intergenic
945456919 2:210061303-210061325 CTCTGTTCACCATTCCCAGTGGG + Intronic
946355709 2:219183000-219183022 CTCTGCCCTCATGTCCCACTTGG + Exonic
946434789 2:219644315-219644337 CTTTCCTCTCCTATCCCTCTGGG - Intergenic
947141700 2:227024863-227024885 TTCTGAACTCCGTTCCCACTGGG - Intronic
947145001 2:227056088-227056110 CCCGGCTGTCCTTTCCCACCTGG + Exonic
948571534 2:238920814-238920836 CTCTGCTCCCCTTCCCTACCTGG + Intergenic
948733199 2:239980130-239980152 ATCTGTTCTCCCTGCCCACTAGG + Intronic
1169067409 20:2701813-2701835 CTCTGGCCTTCTCTCCCACTAGG + Intronic
1169158221 20:3352489-3352511 ATCTACTCTCCTTTTCCAGTTGG + Intronic
1170299187 20:14863373-14863395 CCCTGCCCTCCTTTACCCCTTGG - Intronic
1170311229 20:14994496-14994518 CTCTGCTCTGCTTTTTGACTGGG - Intronic
1170836285 20:19887457-19887479 ACCTGCTCTCATTTCCCTCTTGG + Intronic
1170932578 20:20782114-20782136 CACTTCTTTCCTCTCCCACTAGG - Intergenic
1171448076 20:25218652-25218674 CTCTGCCCTCCATTCTCAGTGGG + Intronic
1172155868 20:32823957-32823979 CTCTGCTCTCCTTGCTCACTGGG + Intronic
1172158752 20:32849638-32849660 CTCTGCTCCCCTTGCCCACTGGG + Exonic
1172758775 20:37307419-37307441 CTCGCCTTTCCTTTCCCACACGG - Intronic
1173406856 20:42773799-42773821 CTCTGCACTCCCTCCCCACCTGG - Intronic
1174067857 20:47878637-47878659 CTCAGGCCTCATTTCCCACTGGG - Intergenic
1174320593 20:49738964-49738986 CTCTGCCCTCCAGGCCCACTGGG + Intergenic
1174386920 20:50192898-50192920 CTCTTCTCCCCTTTCCCCCGGGG - Intergenic
1174482155 20:50838896-50838918 CCCTGCTCTCCTTTCTCCATGGG - Intronic
1175114601 20:56673342-56673364 TTGTGCTCTCCTTTCCCAGATGG + Intergenic
1175188886 20:57198248-57198270 CTATCCTCTCCTTTCTCACAGGG + Intronic
1176102170 20:63369597-63369619 CTCTGCTCACCCTGCCCACCCGG + Intronic
1178497990 21:33103075-33103097 CTCTGCTCTCTCTTCCCCCCGGG - Intergenic
1178942703 21:36920365-36920387 CTCTGCCCCACCTTCCCACTAGG - Intronic
1180991016 22:19936263-19936285 CTCAGCTTTCCTCTCCCACTCGG + Intronic
1181519277 22:23436146-23436168 CTCTGCTCTCCCTGCACGCTGGG - Intergenic
1181993558 22:26857180-26857202 CTCTCCACTCCTTGCCCCCTGGG + Intergenic
1182411490 22:30190600-30190622 TTCTGCTTTTCTTTCCCTCTTGG - Intergenic
1183029440 22:35092391-35092413 CTGTTCTCACCTTGCCCACTGGG + Intergenic
1183174160 22:36210417-36210439 CTTTGTTCTCCTTTTCTACTAGG - Intergenic
1183360186 22:37379316-37379338 CACTGCTCCCCTCTCCCTCTGGG - Intronic
1184138708 22:42565029-42565051 CTTTGCTCTCTTTTCGGACTCGG - Intronic
1184279122 22:43427077-43427099 CTGCTCTCTCCTTGCCCACTGGG - Intronic
1185122149 22:48977728-48977750 CTCTGCTGCATTTTCCCACTGGG - Intergenic
949168685 3:971898-971920 GTCATCTCTCCTTTCCCAGTTGG - Intergenic
951417256 3:22439994-22440016 CTCTTTTCTCCACTCCCACTTGG + Intergenic
951447345 3:22798228-22798250 CCCTGCTCTCTTTTCACACTGGG + Intergenic
951908162 3:27723267-27723289 CTCTACAAACCTTTCCCACTGGG - Intergenic
952787482 3:37169964-37169986 CTCTGCCTTCCTTTCCTCCTCGG - Intronic
953535685 3:43775042-43775064 CTGTGCTTTCCTGGCCCACTTGG - Intergenic
953731586 3:45454234-45454256 CTCTACTCTTCTTTGCCATTAGG - Intronic
954051955 3:47986641-47986663 CCCTGCTCTTCTTTCAGACTAGG + Intronic
954685947 3:52370276-52370298 CACTGCTCTCCTTGCTCTCTGGG + Intronic
954750606 3:52811342-52811364 TCTTGCTCTCCTTTTCCACTGGG + Intergenic
954792004 3:53140196-53140218 CCCTGCTTTCTTTTCCCTCTTGG - Intergenic
954931008 3:54281240-54281262 CCCTGCCCTCCCTTGCCACTTGG + Intronic
954934685 3:54315543-54315565 CTCTACTCCCCTTCCCCACAAGG + Intronic
955029118 3:55199424-55199446 CTCTCCTCTCCATTCCCAACTGG - Intergenic
955722938 3:61902936-61902958 CTCAGCTCTCCTTTCCCACCAGG + Intronic
956224014 3:66935813-66935835 CTTTTGTCTCCTTTTCCACTAGG + Intergenic
956417876 3:69052166-69052188 CTTCGCTCCCCTTTTCCACTCGG + Exonic
956785480 3:72638711-72638733 CCCTGCTCCCATTTCCCCCTAGG - Intergenic
957049167 3:75398101-75398123 CTTTGCTCTCTTTTCGGACTCGG + Intergenic
957728608 3:84102256-84102278 CTCTTCTGTCCTTTCCTGCTGGG - Intergenic
958043387 3:88252989-88253011 AACTGCTCTCTGTTCCCACTGGG - Intergenic
958508151 3:95008924-95008946 CTCTGTTCTCCTTACCCTCAAGG - Intergenic
959455047 3:106549277-106549299 CTCTCCACTCCTTTCCTACTTGG + Intergenic
960462618 3:117955111-117955133 CTCTGCTGTCCTGGCTCACTGGG + Intergenic
960509169 3:118527296-118527318 CCCAGCTCTCCTACCCCACTAGG + Intergenic
960648910 3:119924227-119924249 CCCTGCTCTTCCTTCCTACTTGG - Intronic
960872629 3:122265067-122265089 CTCTGCTGTCATTTTCCACCAGG + Intronic
960999067 3:123360321-123360343 TTCTCCTCTCCTTTCCAGCTAGG + Intronic
961379198 3:126486311-126486333 TTCTGATCTCCTTTCCCTATTGG - Intronic
961382161 3:126501947-126501969 CTCTGCTCACGGTTCCCACAGGG - Exonic
961383329 3:126509868-126509890 CCCTGCTCTCCCTCCCCACTTGG + Intronic
961389373 3:126543105-126543127 GTCTCCTCTCCTCTCCCACGCGG + Exonic
962900352 3:139756237-139756259 GTCTCCTCTCCTCTCCCCCTAGG + Intergenic
963910421 3:150812642-150812664 CGCTTCCCTCCTTTCCCACCAGG - Intergenic
964262990 3:154861347-154861369 CTCTGCTCCACCTTTCCACTTGG + Intergenic
965268499 3:166581142-166581164 GACTGCTTTTCTTTCCCACTTGG - Intergenic
965836523 3:172859466-172859488 CTCTGGTCTCCTTTACCCATGGG + Intergenic
966355681 3:179076111-179076133 CTCAGCTCTCCATATCCACTGGG + Intergenic
967084247 3:186079755-186079777 CACTCCTATCCTTTCTCACTGGG - Intronic
968116537 3:196094742-196094764 CTCTGCTCTCATTGCCTACTTGG - Intergenic
968471516 4:784696-784718 CTCTGCTCTCCCTCCCACCTAGG - Intergenic
968709285 4:2101503-2101525 CTGTGGTCCACTTTCCCACTGGG + Intronic
969277776 4:6148610-6148632 CTCTGCTCCTGTTTCCCACAAGG - Intronic
969474350 4:7412770-7412792 CTCAGCTGTCCTTTCCCCATGGG + Intronic
969656732 4:8503082-8503104 CCCTGGGCTGCTTTCCCACTGGG + Intergenic
969841845 4:9888655-9888677 CTTTCCTTTCCTTTCCCACTGGG - Intronic
970112765 4:12657361-12657383 CTCTCTTCTCCTATCCCACTTGG + Intergenic
970574833 4:17417052-17417074 CACTGCTCTCTTTGCCCACATGG + Intergenic
971098050 4:23430571-23430593 CTCTCCTCACCTCTCCCAATTGG + Intergenic
971171289 4:24235865-24235887 TTCTGCTCTCCTTTTCTGCTTGG - Intergenic
971925966 4:33010013-33010035 CTCTGCTCCCCTTTCCCACTGGG - Intergenic
972153720 4:36129705-36129727 CTCTTCTCTTCCTGCCCACTGGG + Intronic
973345372 4:49049241-49049263 CTCTACTTACCTTTCCCAATGGG + Intronic
973858101 4:55033533-55033555 CCCTCCGCTCCTTTCCCCCTCGG + Intergenic
974190330 4:58495498-58495520 CTCTCATTTCCTTTCCAACTTGG - Intergenic
974998475 4:69192832-69192854 CTCAGCTTTTCTCTCCCACTTGG + Intronic
975970124 4:80023832-80023854 CTCTGCTCCCCTTTTCAACCTGG - Intronic
976072732 4:81260404-81260426 CTTAGCACTCTTTTCCCACTTGG - Intergenic
978008704 4:103651986-103652008 CTTTCCTCTCCTTTCCCAAGTGG + Intronic
978035328 4:103986074-103986096 CTCTGCCTTCCATGCCCACTGGG + Intergenic
978529382 4:109698887-109698909 CTCTGCTCTCCATTCTCAACTGG + Intronic
978682012 4:111392705-111392727 CTGGAGTCTCCTTTCCCACTAGG - Intergenic
979460657 4:120978943-120978965 CTCTGCTCTTCTTTCACATAAGG + Intergenic
979951758 4:126901512-126901534 CTTTTCACTCCTTTACCACTTGG + Intergenic
980937699 4:139241980-139242002 CTCTCTTTTCCTTTCCAACTGGG - Intergenic
980978485 4:139633707-139633729 CTCAGCTTTCCTCTCCCACTCGG + Intergenic
981364747 4:143889380-143889402 CTCTGCTCTCCTTTCCCACTGGG - Intronic
981375247 4:144007651-144007673 CTCTGCTCTCCTTTCCCACTGGG - Intronic
981385863 4:144129852-144129874 CTCTGCTCTCCTTTCCCACTGGG - Intronic
982456463 4:155615333-155615355 AACTGCACTCCTTTCCCACTGGG - Intergenic
982625610 4:157762216-157762238 CTCTCTTCTCCTTTCCATCTGGG - Intergenic
982966690 4:161917808-161917830 CTCAACTCTCCTTTCCCAATGGG + Intronic
983343805 4:166501497-166501519 CTATCCTGTCCTTTCCCCCTTGG - Intergenic
984082169 4:175260762-175260784 CTCTTCTCTGCTGTCCCCCTGGG - Intergenic
984926164 4:184808837-184808859 CTCTGCTTTCCTCTCCAGCTGGG - Intronic
985034128 4:185821119-185821141 CTCTGCTCCCCTTGCCCCCCGGG - Intronic
987726358 5:21704983-21705005 CTGAGCTCTCCCTTCCCAATGGG + Intergenic
988587149 5:32517223-32517245 TTCGGCTCTCCTTTACCACTTGG - Intergenic
989733683 5:44677499-44677521 CTCTGCTCTGCTTTCTAGCTGGG - Intergenic
990009239 5:50976020-50976042 CTCTGGACTGCTTACCCACTTGG + Intergenic
990480655 5:56207098-56207120 CTCTCCTCCCCTTCCCCCCTTGG + Intronic
992154336 5:73939982-73940004 ATTTGCCCTCCTTTCCCACCTGG + Intronic
993602239 5:89941518-89941540 CTCTCCCTTCCTTTACCACTGGG - Intergenic
996105470 5:119497017-119497039 CTCTGATCTCCTTTCCCATTAGG - Intronic
996269458 5:121585355-121585377 CTCTGTCCTCCATGCCCACTGGG + Intergenic
997599992 5:135132510-135132532 CTTTGCTCTTCTCTCCCTCTGGG - Intronic
997902504 5:137779985-137780007 CTCTGCTCTTCTTTCCTTCTTGG + Intergenic
998093582 5:139384494-139384516 CTGTCCTCTCCTCTCCCTCTTGG + Intronic
998385746 5:141756265-141756287 CTCTGCTCTCCCTCCCCAGCAGG - Intergenic
999362504 5:150997852-150997874 CTCTCTTTTCCTTTCCCACTCGG - Intergenic
999399117 5:151250883-151250905 CTCTCTTTTCCTTTCCAACTCGG - Intronic
1000075218 5:157778269-157778291 CTGTGCTTTCCTTTTCCATTTGG + Intergenic
1001039169 5:168320446-168320468 GTCTGCTCTCCTTACTAACTTGG + Intronic
1002258630 5:177978585-177978607 GTCTGCTCTCCAGTCCCACAGGG - Intergenic
1002427454 5:179184727-179184749 CTGGTCTCTCCTTCCCCACTGGG + Intronic
1002501231 5:179648961-179648983 GTCTGCTCTCCAGTCCCACAGGG + Intergenic
1002948397 6:1784485-1784507 CTCTGCTCTCCTTCCCGCCCCGG - Intronic
1003655516 6:8003480-8003502 TTCTGCTTTGCTTTCCCACCTGG + Intronic
1004011407 6:11691617-11691639 CTCTGCTCTCGTTTTCCTTTAGG + Intergenic
1004240160 6:13914028-13914050 CTCTGCTCTGTTTTCCCAGTTGG - Intergenic
1004439984 6:15641123-15641145 CTTTGTTCCCCTTTCCCTCTTGG + Intronic
1004458204 6:15811376-15811398 CTCTACTATCCTTTCTCACATGG + Intergenic
1004573308 6:16869073-16869095 CTTCACTCTCCTTTGCCACTAGG + Intergenic
1004958043 6:20752089-20752111 CTCTTCTCTCCGTTTCCTCTTGG + Intronic
1005892842 6:30154152-30154174 CTCTGGGCTCCTTCCCCACACGG - Exonic
1006135767 6:31895878-31895900 CCCTCATCTCCTTTCCCACTGGG + Intronic
1006155184 6:32009869-32009891 CCCTGCTCTCCTCTCCCAGGTGG - Intergenic
1006161490 6:32042603-32042625 CCCTGCTCTCCTCTCCCAGGTGG - Exonic
1007172378 6:39872866-39872888 TTTTGCTCTCCTCTCCCCCTGGG + Intronic
1007337791 6:41167185-41167207 CTCTCTTCTCCTTTCTCCCTAGG + Intergenic
1007349031 6:41255312-41255334 CTGTGATCCACTTTCCCACTGGG + Intergenic
1007350975 6:41273244-41273266 CTCTGCTGTCCATTCTCTCTTGG + Intronic
1007712942 6:43836213-43836235 ATCTTCTCTCCTTTCTCACAAGG - Intergenic
1008668000 6:53736014-53736036 GTCTGCTCTGGTTTCTCACTGGG - Intergenic
1013447599 6:110246645-110246667 CTCAGATATCCATTCCCACTGGG - Intronic
1013823624 6:114184776-114184798 CTCTGCCCTCCAGACCCACTGGG - Intronic
1016058978 6:139608636-139608658 CTCTTCTCTCCCATCCAACTTGG + Intergenic
1017932421 6:158969608-158969630 CTCTTCTCTCCTCTCCTTCTGGG + Intergenic
1018301803 6:162410602-162410624 CTCTGCTCTCCTTTCCTCATTGG - Intronic
1018329331 6:162710530-162710552 TTCACCTCCCCTTTCCCACTGGG - Intronic
1019603373 7:1896196-1896218 CCCTGCCCTCCTTTCCGCCTTGG - Intronic
1021231908 7:18095159-18095181 CTCTGCCCTACTTTTTCACTGGG + Intronic
1021840935 7:24721448-24721470 CTCAGCTCTGCCCTCCCACTGGG + Intronic
1023062623 7:36343322-36343344 CTCTCCTCTCCTCTCCTACAGGG - Intronic
1023107597 7:36777826-36777848 CTCTGCTGTCCTTACCTACGAGG - Intergenic
1024043947 7:45574949-45574971 CTCTGCTGTCCTTTCGCGCTGGG + Exonic
1024599183 7:50964540-50964562 CTCTCTTTTCCTTTCCAACTTGG + Intergenic
1026716530 7:72794172-72794194 CTCTGCTCTACTTGACCAATGGG - Intronic
1029617184 7:101666290-101666312 CTCTCTTCTCCCTTCCCACAGGG + Intergenic
1030143863 7:106332884-106332906 CTCTCTTTTCCTTTCCAACTCGG + Intergenic
1030279093 7:107751724-107751746 CTTTTCTCTCCTTTCCCTCTCGG + Intronic
1031239675 7:119220779-119220801 TTTTCCTCTCCTTTCCCACATGG + Intergenic
1032718243 7:134529105-134529127 CTCTTCTCTCCTGTCCCTCATGG + Intronic
1032723080 7:134566643-134566665 CTCTTCTCTCCTGTCCCTCATGG + Intronic
1032789354 7:135231246-135231268 CTCTGCACTCCATGCCCCCTTGG - Intergenic
1033408544 7:141094303-141094325 CTTTGCTCTATTTTCCCATTAGG - Intronic
1034399339 7:150851815-150851837 CTATTCTTTCCTTTCCAACTAGG + Intronic
1034705618 7:153140260-153140282 CGCTGCTCTCCTGTCCGAGTGGG + Intergenic
1034716328 7:153245870-153245892 CTTTGCTCTCCTTTCCAGTTGGG + Intergenic
1034937520 7:155209562-155209584 CTCTGCTTTCTTTCCACACTTGG + Intergenic
1035587400 8:786423-786445 CTCTGCTGGCCCTTCCCTCTCGG - Intergenic
1036080844 8:5553892-5553914 CTCTGCCCTCCAGGCCCACTGGG + Intergenic
1036127448 8:6075909-6075931 CACAGCTCTCCTTGCTCACTGGG - Intergenic
1036191100 8:6671161-6671183 CTCTGCTCTCTTTTCTTCCTAGG - Intergenic
1036287183 8:7453376-7453398 GTCTTCTCTCCTATCCCCCTGGG + Intronic
1036334298 8:7858147-7858169 GTCTTCTCTCCTATCCCCCTGGG - Intronic
1037777488 8:21845161-21845183 TCCTGCTCTCCTTTCCCAAAGGG - Intergenic
1037940306 8:22946223-22946245 CTCTACTCACCTTTCCCAGAAGG - Intronic
1039397998 8:37243863-37243885 CTCTCCTCTCCTCTGCCACCTGG + Intergenic
1039763069 8:40599184-40599206 CTCTGCCCTCCTATACTACTTGG + Intronic
1040593679 8:48818554-48818576 CTGTTCTCTCCTCTCCCACTAGG - Intergenic
1040698083 8:50026958-50026980 CTCTGGTTTCCATTCCCTCTGGG + Intronic
1046308154 8:112398178-112398200 CTCTGTTCTTCAGTCCCACTGGG + Intronic
1046810144 8:118524484-118524506 CTCTGCTCTTCCCTCCCCCTAGG + Intronic
1046981052 8:120336688-120336710 CCCTACTTTCCTTTCCAACTTGG + Intronic
1047958896 8:129996515-129996537 CTCCCCTGCCCTTTCCCACTTGG - Intronic
1048209937 8:132446420-132446442 CTCTGCTCTCCTTGGCTGCTGGG + Intronic
1048372394 8:133790789-133790811 CTCAGCTCTCCTTTCCCTGGCGG + Intergenic
1048376675 8:133828623-133828645 CTTTACTCTCTTTTCCCAATAGG - Intergenic
1048496500 8:134940259-134940281 CCCTGTGTTCCTTTCCCACTAGG - Intergenic
1048568016 8:135624274-135624296 CTCTGCTCCCTTTGCCCACTGGG - Intronic
1048569994 8:135644396-135644418 CCCTGCTCTCCTGTCCCATGTGG + Intronic
1048938182 8:139374415-139374437 CTCTCCTCTCCTCACCCCCTGGG + Intergenic
1049052788 8:140211932-140211954 GTCTGCTGTCCGTTCCCACCTGG - Intronic
1049241860 8:141541858-141541880 CTCTGCCCTCCTGTCCCACCAGG + Intergenic
1049417256 8:142500741-142500763 CTCTGCCCTCCTTGCTCACGTGG - Intronic
1049502723 8:142976032-142976054 CGCTGGTCTCCCATCCCACTGGG - Intergenic
1049597634 8:143492083-143492105 TTCTCCTCTCCATTCCCTCTCGG - Intronic
1051246602 9:15118062-15118084 CATTTCTCTCCTTCCCCACTGGG + Intergenic
1052188685 9:25630335-25630357 TTCTGCTCTCCTTTCTGCCTGGG - Intergenic
1052474165 9:28937531-28937553 CTCTGCTTTCCAGTCCCAATAGG + Intergenic
1053032263 9:34790837-34790859 CTCTGCTCTTCTTTCGCCCAAGG - Intergenic
1055511595 9:77000532-77000554 CTGTGCTATCCTGTGCCACTGGG - Intergenic
1055936577 9:81609897-81609919 CTCTGCTCTGCTCTGCCATTTGG - Intronic
1056022080 9:82448910-82448932 TTCTGGTCTTTTTTCCCACTTGG - Intergenic
1056273635 9:84971480-84971502 CCCTGGGCTCCTTCCCCACTGGG + Intronic
1056335487 9:85564224-85564246 CTCTGCTCTTCAGGCCCACTGGG - Intronic
1056655878 9:88508713-88508735 CACTGCTGGCCTCTCCCACTGGG + Intergenic
1056707000 9:88959883-88959905 CTCAACTCTCCTTCCCCACGTGG + Intergenic
1057029955 9:91768037-91768059 CTCTGCTCTTTCTTCCCTCTAGG - Intronic
1057743781 9:97735281-97735303 CTCTTCTCTCCCCTCCCACAGGG - Intergenic
1059221436 9:112624352-112624374 CATTGCTTTCCCTTCCCACTTGG + Intronic
1060020634 9:120127641-120127663 CTCTGCTTTTTTTTCCCTCTGGG + Intergenic
1060196328 9:121625955-121625977 CTCTCCTTTCCTTTCCCTCCTGG + Intronic
1060341010 9:122777152-122777174 CTCTGAGCTCCCGTCCCACTTGG + Intergenic
1060817900 9:126645016-126645038 CTCGGCTCCCCTGTCCCACCTGG + Intronic
1061973474 9:134056767-134056789 CTCAGCCCTCCCTCCCCACTGGG - Intronic
1062276462 9:135733646-135733668 CCCTGCACTCCTCTCCCACTTGG + Intronic
1062285612 9:135771286-135771308 GTCTGGTCTCCTGTCCCACCTGG - Intronic
1186403195 X:9278451-9278473 TTCTGCTTTCCTTTCCCCCAAGG + Intergenic
1186407412 X:9316332-9316354 TTCTGTTCTGCTTTCCCTCTGGG - Intergenic
1187018716 X:15357442-15357464 CTCTTCTCCGCTTTCCCTCTGGG + Intronic
1187562178 X:20413217-20413239 TACTGCTCTCCTCTCCAACTGGG - Intergenic
1189129810 X:38485891-38485913 CACCACCCTCCTTTCCCACTTGG + Intronic
1189439348 X:41020403-41020425 CTCTGCCCTGCTTTTCCATTTGG - Intergenic
1189544593 X:42028415-42028437 ATCTGATCTCCTTTCCCATAGGG - Intergenic
1189553987 X:42123147-42123169 CTCTGCTCAGCATTCTCACTGGG - Intergenic
1192226095 X:69229039-69229061 CTATGCTCTCCCTTCCTCCTAGG - Intergenic
1192237812 X:69306960-69306982 CTATGGTCTCCTTTCCAATTTGG + Intergenic
1192340328 X:70258695-70258717 CTGTGCTCTACTTGCTCACTGGG - Exonic
1195616457 X:106916345-106916367 CAATGCTCTCCCTTCCCTCTAGG - Intronic
1195884507 X:109625053-109625075 CGCTGCTGACCTTTCCCCCTGGG + Exonic
1196129717 X:112142249-112142271 CTCTGCTCTCCTCACCCTCATGG - Intergenic
1196433039 X:115647871-115647893 ATTTGTTCTCCTTTCACACTAGG + Exonic
1196974367 X:121142211-121142233 CTCTCTTTTCCTTTCCAACTTGG - Intergenic
1198945164 X:142003795-142003817 CTCTGTTCCTCTTTCCCTCTTGG - Intergenic
1201475864 Y:14380004-14380026 CTCAGCTTTTCTCTCCCACTTGG - Intergenic