ID: 981385864

View in Genome Browser
Species Human (GRCh38)
Location 4:144129853-144129875
Sequence ACTCTGCTCTCCTTTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 3, 1: 0, 2: 3, 3: 38, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981385864_981385869 9 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385869 4:144129885-144129907 GGCTTTGCCACCAAATGGTTGGG 0: 2
1: 1
2: 1
3: 11
4: 109
981385864_981385868 8 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data
981385864_981385866 4 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385866 4:144129880-144129902 TTCCTGGCTTTGCCACCAAATGG 0: 2
1: 1
2: 4
3: 37
4: 307
981385864_981385870 10 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385870 4:144129886-144129908 GCTTTGCCACCAAATGGTTGGGG 0: 2
1: 1
2: 2
3: 8
4: 119
981385864_981385871 11 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385871 4:144129887-144129909 CTTTGCCACCAAATGGTTGGGGG 0: 2
1: 1
2: 0
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981385864 Original CRISPR ACTCTGCTCTCCTTTCCCAC TGG (reversed) Intronic
901331020 1:8408591-8408613 ACTCTGCCCTCCTTTCTCTGTGG - Intronic
903191106 1:21656608-21656630 ACTCTTCCCTCCCTTCCCAGGGG - Intronic
903915454 1:26760935-26760957 ACTCTGCTCTCCTTGGCTGCTGG - Exonic
904919478 1:33995723-33995745 TCTCTGCTCTCTTTTCACCCAGG + Intronic
905182361 1:36175205-36175227 TCTCTGTTCTCCTCTCCTACAGG - Intronic
910285110 1:85545121-85545143 ACTCTGCCCTCCATACTCACAGG + Intronic
910757416 1:90707562-90707584 TCTCTCCTCTCCTTGTCCACTGG - Intergenic
910843943 1:91587475-91587497 ATTCAGTTCTCCTTTCCCTCTGG + Intergenic
911992297 1:104715412-104715434 CCTCTGACCTCCTTTCCCAAAGG - Intergenic
912595386 1:110870899-110870921 TCTCTGCTCCCATTGCCCACAGG - Intergenic
913195399 1:116452354-116452376 ACCCTGCTCCCCTGACCCACAGG - Intergenic
913260811 1:116996395-116996417 TCTTTGCTCTTCCTTCCCACTGG - Intergenic
914855029 1:151344536-151344558 ACTCTGCTCCCCTCTCACTCAGG - Exonic
914948621 1:152089558-152089580 GCTTTGCTCTCCTTGCCCAGAGG + Intergenic
915735888 1:158084624-158084646 GCTCACCTCTCCTTTCCCACAGG + Intronic
915938899 1:160106016-160106038 AGTCTCCTCTCCTTTGCCACTGG - Intergenic
916474769 1:165158713-165158735 TCTCAGCTCCCCTTTCCCTCAGG + Intergenic
917087598 1:171319334-171319356 ACACTGCTCTGCTCTGCCACTGG + Intronic
918132719 1:181643689-181643711 ACTCTGCTGCATTTTCCCACTGG + Intronic
918452331 1:184671613-184671635 ACTCAGCTCTGCTGTCCCAAAGG + Intergenic
919915291 1:202135220-202135242 ACTCTACTCTGGTTTCCCCCAGG - Exonic
920051014 1:203165239-203165261 ACTCTGCCCTCCTCTCCCCCAGG + Exonic
920060393 1:203223259-203223281 ACTCTGAGCTCCACTCCCACAGG - Exonic
920839413 1:209541337-209541359 ACTCTGGTCTGCTCTCCCAGAGG + Intergenic
920930109 1:210380191-210380213 ACTGTGAGCTCCTTTCCGACAGG - Intronic
921169197 1:212531059-212531081 AGTCTGCCCTCCTTACCCATGGG + Intergenic
921833483 1:219753704-219753726 CCTCTGCAATCCTTTCCCAAAGG + Intronic
922560774 1:226568139-226568161 AGTCTCCTGACCTTTCCCACTGG - Intronic
922887803 1:229033264-229033286 TGTCTGCTTTCCTTTGCCACTGG - Intergenic
923025505 1:230200675-230200697 CCACTGCTCTCCTTGCACACAGG + Intronic
923328627 1:232902134-232902156 AGTCAGCACTCCTTACCCACTGG - Intergenic
1067221053 10:44344751-44344773 ATTCTGATCTCCTTGGCCACAGG + Intergenic
1067256447 10:44647365-44647387 CCTCTCCTCTCCTTGCCCCCAGG + Intergenic
1069237492 10:66095304-66095326 ACTCTGCTCTCCTATCTTTCTGG - Intronic
1069689510 10:70340666-70340688 AAGCTGGTCTCCTTTCCCATTGG - Exonic
1070300697 10:75201827-75201849 ACTCTCCTCACCTTTCCCCGTGG + Intergenic
1070760836 10:79023535-79023557 ACTCTCCTGTCCTGTCCAACCGG + Intergenic
1071903622 10:90147695-90147717 CCTTTGCTCTCCTGTTCCACTGG - Intergenic
1072339366 10:94431738-94431760 TCTCTGCTCCCCATCCCCACAGG - Intronic
1072686856 10:97542625-97542647 GCCCTGCTCTCCTTCCCAACAGG - Intronic
1072755726 10:98019592-98019614 ACTCTGCTCCCTTCTCCCAAGGG + Intronic
1073180642 10:101580953-101580975 TCTTTCCTCTCCTTTCCCACAGG - Intronic
1073211589 10:101807729-101807751 ACTTTCCTCTTCTGTCCCACAGG - Exonic
1074052431 10:109892316-109892338 TATCTGCCCTCCGTTCCCACAGG + Intronic
1074437196 10:113444255-113444277 CCTCTGTCCTTCTTTCCCACTGG + Intergenic
1074909285 10:117892902-117892924 ACTCCTCTCTCCTTCTCCACAGG + Intergenic
1075951420 10:126481007-126481029 CCTCTGCTCTGCAGTCCCACTGG + Intronic
1076404164 10:130201296-130201318 GCTCTGCCCTCCTCTCCCCCTGG - Intergenic
1077304770 11:1864135-1864157 TCTCCTCTCTCCTTTCCCTCTGG - Intronic
1077784564 11:5368653-5368675 ACTATGCTCTGCTTTCTCACAGG - Intronic
1078609827 11:12810472-12810494 ACTCTGGGCTCCTTGCCCACAGG + Intronic
1080135248 11:28846369-28846391 CCTTAGCTCTCCTTTCCTACAGG + Intergenic
1080236208 11:30071200-30071222 ACTCTGCTCTACTTACACTCAGG + Intergenic
1082940943 11:58704386-58704408 ACTCTTGTCTCCTGTACCACTGG - Intronic
1083610643 11:64002672-64002694 ACCCTGCTCTCCTTAGCCATAGG + Intronic
1084267117 11:68010737-68010759 ACTGTGCGCCCCTTCCCCACAGG + Intronic
1084846028 11:71900552-71900574 ATTTTGCTCTCCTCCCCCACTGG + Intronic
1084904781 11:72337104-72337126 ATTCTCCTCTACTTTCCCAGAGG + Intronic
1085521350 11:77140626-77140648 GGTCTGCTCCCCTTCCCCACTGG - Intronic
1085621378 11:78040419-78040441 ACTCTGCTCCTCTTTCTCTCTGG + Intronic
1087651618 11:100874935-100874957 ACTCTGTTCTCTTTTACCTCAGG + Intronic
1088470914 11:110186997-110187019 ACTGTGCTCTCCTCTGTCACAGG + Intronic
1089011032 11:115131984-115132006 ACTCTGGTCTAGTTTCCCCCTGG + Intergenic
1089162845 11:116452788-116452810 GCTCTGCTCTCCTTGGCCATGGG - Intergenic
1090402036 11:126455056-126455078 TCCCTGTTCTCCATTCCCACAGG + Intronic
1090672628 11:128959780-128959802 GCTCTGCTCTCCTTCCAGACAGG + Intergenic
1091129466 11:133133486-133133508 ACTCTCCTCTCCTTGCCCCCTGG + Intronic
1091336103 11:134767441-134767463 GCTCTGCCCTACTTTACCACTGG + Intergenic
1091558167 12:1591763-1591785 GCTCTGCTCCTGTTTCCCACAGG + Intronic
1094051078 12:26221364-26221386 ATTATCCTCTCTTTTCCCACTGG + Intronic
1096473932 12:51896571-51896593 TCTCCTCTCTCCTTTCCCACAGG + Intergenic
1097176490 12:57146434-57146456 AGTGTGCTGTCCTTTACCACTGG - Intronic
1098108576 12:67097240-67097262 AATCTTCTCTCCTTTTCCTCTGG + Intergenic
1100782205 12:98039529-98039551 ACTTTGCTCTTTTTTCCCCCTGG - Intergenic
1101323956 12:103698285-103698307 CTTCTCCTCTCCTTCCCCACAGG + Intronic
1102568398 12:113812223-113812245 ACCCTCCTCTCCTTCCCCTCTGG - Intergenic
1103347931 12:120263929-120263951 ACTTTGCTCCCAGTTCCCACTGG + Intronic
1104349959 12:128036375-128036397 ACTCATCTCTCCTCTCCCAGTGG - Intergenic
1107790569 13:43998157-43998179 GATCTGCTCTCCATTCCCCCAGG - Intergenic
1108878078 13:55073134-55073156 CTCCTGCTCTCCTTTCCCTCTGG - Intergenic
1108898339 13:55364063-55364085 TCTCTGCCCTCCTTTCTCAATGG - Intergenic
1110456248 13:75693520-75693542 AATCTGTTCTCCTTTTCCTCCGG + Intronic
1112519906 13:100086094-100086116 GATCTGCTCTCCTTTGCTACTGG + Intergenic
1112778237 13:102868569-102868591 ACTCATCTCTCCTTTCCCCAGGG - Intronic
1113795632 13:113056093-113056115 ACACTGCACACCTTTCCCACAGG - Intronic
1113877834 13:113605824-113605846 CCACTGCGCTGCTTTCCCACAGG - Intronic
1116644523 14:47509632-47509654 ACTCTGCTTTCCAGGCCCACTGG - Intronic
1117091481 14:52255086-52255108 TTTATGCTCTCCTTTTCCACTGG + Intergenic
1117803721 14:59469055-59469077 TTTCTGCTCTCCCTACCCACAGG - Intronic
1118727539 14:68639732-68639754 GCTCTGCCCACCTCTCCCACAGG - Intronic
1119599863 14:75968320-75968342 ATACTGCCCACCTTTCCCACAGG - Intronic
1119785678 14:77311938-77311960 ACACTGCTCACCTTTCCCAGGGG + Exonic
1120429895 14:84400582-84400604 TCTCTGCACTCATTTTCCACAGG - Intergenic
1121659444 14:95624135-95624157 ACTTCCCTCTCCTTTCCCTCCGG - Intergenic
1121790744 14:96697795-96697817 AAACTCCTCTCCTTTTCCACAGG - Intergenic
1121832931 14:97067356-97067378 TCACTGCTCTCCTGTCCCACCGG - Intergenic
1122673118 14:103386972-103386994 ACTCTGTTCTCCTCTAACACTGG + Intronic
1123928979 15:25148687-25148709 ACTCTTCTCTCCCTTTCCAAAGG - Intergenic
1128517705 15:68353402-68353424 ACTCTGCTATTCTTTCCAAGGGG + Intronic
1129613918 15:77083157-77083179 ACTCTACCCTCCTTGCCCAAAGG - Intronic
1129615869 15:77098401-77098423 ACTCTGCCCTTCTGTGCCACTGG - Intergenic
1132501710 16:287359-287381 AGTGTGCCCTCCTTTACCACGGG + Intergenic
1132937150 16:2486939-2486961 ACTCTGCCTTCCTTTCTCCCTGG + Intronic
1133415718 16:5605516-5605538 ACTCTGCCCTCCTATACCAAAGG - Intergenic
1133442304 16:5831047-5831069 TATCTGTTCTCCTTACCCACAGG + Intergenic
1134222874 16:12369053-12369075 ACTCCACTCACCTCTCCCACAGG + Intronic
1135496180 16:22953497-22953519 TTTCTGCTCTCCTTGCCCAGAGG + Intergenic
1135627324 16:24007477-24007499 CTTCTGCTCTCATTTGCCACGGG + Intronic
1136289814 16:29264792-29264814 ATTCCTCTCTCCCTTCCCACGGG - Intergenic
1138570293 16:57867121-57867143 AATGTGCTCTCCTTCCCCCCCGG + Intergenic
1139355138 16:66363128-66363150 ACCCTCCTCTCCTTTCCCACCGG - Intergenic
1139450432 16:67024792-67024814 TCTCTGCTTTCCTTTCCCTATGG + Intergenic
1139776509 16:69320049-69320071 CCTCTTCTCACCCTTCCCACAGG - Intronic
1140929545 16:79614337-79614359 ACTCTGCTCTCAGGGCCCACTGG + Intergenic
1141154091 16:81584906-81584928 CCTCTGCTCTCCCTTCACAGGGG - Intronic
1141428254 16:83957346-83957368 ACTCTACTCTCCCATCTCACTGG - Intronic
1141435721 16:83998738-83998760 ACTCTCCTCTCCTTCCTCAGTGG - Intronic
1141616671 16:85213808-85213830 ACTCTGCTCCCCACTCCCACAGG - Intergenic
1141941417 16:87278545-87278567 GCCCTGCCATCCTTTCCCACAGG + Intronic
1142095698 16:88238268-88238290 ATTCCTCTCTCCCTTCCCACGGG - Intergenic
1143582045 17:7833357-7833379 CTTCTCCTCTCCTTTCCCCCAGG + Exonic
1143834075 17:9676036-9676058 TCTCTGCTTCCCCTTCCCACCGG - Intronic
1143995518 17:11003333-11003355 ACTCAGCTCTCCTCTGCCTCAGG - Intergenic
1144225753 17:13144079-13144101 AGTCTTCTCTCCTTTTCTACTGG + Intergenic
1147670096 17:42171858-42171880 TCTTTGCGCTCCTTGCCCACTGG - Exonic
1148540620 17:48477513-48477535 CCTCTGCTCTTGGTTCCCACAGG + Intergenic
1149553612 17:57557699-57557721 CCTCTGCTCCCCATTCCCACTGG - Intronic
1151956600 17:77383240-77383262 GCTGTTCTCTCCTTACCCACAGG + Intronic
1152121226 17:78419946-78419968 CTTCTGCTCTCCCTTCCCAGGGG + Intronic
1152709147 17:81861479-81861501 TCTCTTCCTTCCTTTCCCACGGG + Intergenic
1152884000 17:82837658-82837680 ATCCTCCTCTCATTTCCCACTGG + Intronic
1153062979 18:1013160-1013182 ACTCTCCTCTCCCTTCACAATGG - Intergenic
1154354114 18:13611791-13611813 ACTGCGCGCTCCTTTCCCCCCGG - Intronic
1156888556 18:42164113-42164135 ACTTTGCTCTCTTTTTCCACAGG - Intergenic
1156977204 18:43237574-43237596 ACTCTTCTCTCCTTTTCCACAGG + Intergenic
1157713468 18:49865947-49865969 ACTCCCCTCTCCTCCCCCACAGG + Intronic
1157866127 18:51186389-51186411 CCTCTGCTCTCCTTCCCATCTGG - Intronic
1158645279 18:59240548-59240570 ACTCTGCTCTCCTTGCTGAAGGG + Intergenic
1158773869 18:60553388-60553410 CCTCTGCTCTCCTTATCCTCTGG - Intergenic
1158911226 18:62064851-62064873 TCTCTTCTCTCCTCTCCCTCTGG - Intronic
1159320221 18:66838633-66838655 ATTTTGCTTTCCCTTCCCACAGG + Intergenic
1160374038 18:78397453-78397475 CCTGTGCTGTCCTTTCCCAAAGG - Intergenic
1164753582 19:30673373-30673395 TCTCTGCTCTCCTCTCCCTGGGG + Intronic
1165074696 19:33274162-33274184 ACTCTGCTATGCTTTCCCAGTGG - Intergenic
1165732009 19:38151993-38152015 ACTGTGCCCTCCTGTCCCAGTGG - Intronic
1167007712 19:46786729-46786751 AATCTGCTCCCCTTTCTAACTGG + Intronic
1168505282 19:56928901-56928923 TCTCTCCTTTCCTTTCCCCCAGG + Intergenic
927879749 2:26682073-26682095 ACTGTGCCCTGCTTTCCCAGAGG - Intergenic
928368663 2:30722966-30722988 CTTCTCTTCTCCTTTCCCACAGG + Exonic
928615434 2:33034000-33034022 CATCTGCTCTCCTGTCCCCCAGG - Intronic
930032289 2:47065881-47065903 ACTCTGCCCTCTTCTCCCAGGGG + Intronic
931018722 2:58017386-58017408 ATTCTGCTCTCTTATTCCACAGG + Intronic
932097302 2:68862848-68862870 TCTCTGCACTCCCTTTCCACAGG + Intergenic
933385143 2:81600923-81600945 ACTTTGTTCTCCTTCACCACAGG - Intergenic
933389175 2:81649631-81649653 ACTCTGCTCTCCTGTTCAGCTGG - Intergenic
933656176 2:84888725-84888747 TCTCTGCTGTTCTTTCTCACTGG - Intronic
933750532 2:85600016-85600038 ACTGTGCTCTCCTCCCCCAGTGG - Exonic
934093424 2:88575412-88575434 ACTCAGCTCTCCTAGCCCAATGG - Exonic
934565781 2:95339991-95340013 TCTCTCTTCTCTTTTCCCACTGG - Intronic
936440060 2:112543535-112543557 ACTCTGCTCTACTCTTCCCCTGG - Intronic
937028688 2:118720358-118720380 ATTCTGCTCCCCCTTCCCACAGG + Intergenic
938224440 2:129603618-129603640 CCTTTGCTCTCCTTTTCCATAGG + Intergenic
939469699 2:142604999-142605021 ATTCTTCTCTCTTTTCCCAAAGG + Intergenic
939651509 2:144768115-144768137 TCTCTGCTCTCCTTTGCCTTGGG + Intergenic
941421509 2:165287697-165287719 TCTCTGCTCCCCTTGCCCACTGG + Intronic
941653004 2:168113521-168113543 ACTTTCCTCTCTTTGCCCACTGG - Intronic
942582420 2:177432964-177432986 ACACTTCTCTCCCTTCCCCCAGG + Intronic
942801162 2:179877792-179877814 ACACTTCTCCCCTCTCCCACAGG + Intergenic
944465417 2:199995571-199995593 ATTTCGCTCTTCTTTCCCACTGG + Intronic
944857785 2:203785025-203785047 ACTCGGGTCTCCTTCCACACTGG - Intergenic
944866697 2:203869795-203869817 CCTTTGTTCTCTTTTCCCACAGG - Intronic
947927631 2:233935665-233935687 TCTCTGTTCTCCTTCTCCACTGG + Intronic
948231259 2:236351222-236351244 GGTCTGCTCTCCCTTACCACAGG - Intronic
948330078 2:237157586-237157608 ACCATGCTCTGCTTTTCCACAGG + Intergenic
1168857013 20:1015662-1015684 ACTCTTCTCTCCATCCCCTCTGG + Intergenic
1170652578 20:18256406-18256428 ACTCTGATCTCCTCTCCAGCAGG - Intergenic
1172155867 20:32823956-32823978 GCTCTGCTCTCCTTGCTCACTGG + Intronic
1172158751 20:32849637-32849659 TCTCTGCTCCCCTTGCCCACTGG + Exonic
1173000604 20:39102651-39102673 ACCCTCCTCTTCCTTCCCACAGG - Intergenic
1173438138 20:43050815-43050837 TCTCTGTCCTCCATTCCCACTGG + Intronic
1174386921 20:50192899-50192921 ACTCTTCTCCCCTTTCCCCCGGG - Intergenic
1175188885 20:57198247-57198269 TCTATCCTCTCCTTTCTCACAGG + Intronic
1177859629 21:26437712-26437734 GCTCTGCTGTCCTGTTCCACAGG + Intergenic
1178497991 21:33103076-33103098 TCTCTGCTCTCTCTTCCCCCCGG - Intergenic
1179144154 21:38752640-38752662 TCTCTCCTCTCCCATCCCACCGG - Intergenic
1179594192 21:42431088-42431110 ACTCTGCTCTCTGGTCCCAGGGG + Intronic
1179818647 21:43923724-43923746 ACTCTGTACCCCTTTCCCCCTGG - Intronic
1180079897 21:45481941-45481963 ACTATGCTCTGCTCTCCCCCAGG + Exonic
1180100684 21:45582915-45582937 ACTCTGCTTCCATTCCCCACTGG + Intergenic
1181993557 22:26857179-26857201 ACTCTCCACTCCTTGCCCCCTGG + Intergenic
1183700089 22:39446213-39446235 ACTCTGCTGCCCTGCCCCACTGG - Intergenic
1184278172 22:43422158-43422180 CCTCTGCCCTCCTCTCCCGCTGG - Intronic
1184943504 22:47784999-47785021 TCTGTGCTCTCCTTCCCCCCAGG - Intergenic
1185123920 22:48993381-48993403 ACTCTGCTCCCTTGTCCCAGAGG + Intergenic
1185359841 22:50399438-50399460 ACTCTGCTATCCTTGCCTAGTGG + Intronic
949361531 3:3237374-3237396 CCTCTGCTTTCCTTTCCAACTGG + Intergenic
949426855 3:3926982-3927004 TCTCTGTTCTTCTTCCCCACAGG + Intronic
949539766 3:5023248-5023270 TCTCTCCTCTCCCTTCCCAAGGG + Intergenic
949920827 3:8999229-8999251 CCACTGCTCTGCTTTGCCACTGG - Intronic
950013810 3:9742369-9742391 AGTCTGCACTCCTTCCCCAGAGG + Intronic
950705223 3:14775287-14775309 ACCCTGCTCCCATTTCCCAGAGG - Intergenic
951319694 3:21229229-21229251 AATCTGGTCTCATTCCCCACCGG + Intergenic
951447343 3:22798227-22798249 ACCCTGCTCTCTTTTCACACTGG + Intergenic
951677052 3:25253260-25253282 ACTCAGCCCTCCTTTCCTTCAGG - Intronic
952035024 3:29189853-29189875 ACTCTGCTCAATTTTCCCAAAGG + Intergenic
952119687 3:30227367-30227389 TCTCTCCTCTAATTTCCCACAGG + Intergenic
952405025 3:32997795-32997817 TCTTTGTTCTCCTTTCCCAGAGG + Intronic
952416972 3:33097971-33097993 ACTCCTTTCTCCTTTCCTACCGG + Intergenic
953305166 3:41822229-41822251 TCACTTCTCTCCTGTCCCACTGG + Intronic
954685946 3:52370275-52370297 ACACTGCTCTCCTTGCTCTCTGG + Intronic
955732411 3:62000482-62000504 ACTCTGGTCTCCTTTTTCTCTGG - Intronic
956180782 3:66516455-66516477 ATTCTCCTCTCCTTTCAAACTGG + Intergenic
956893063 3:73631607-73631629 AATCTGCTCTGCTTTCCCTTGGG + Intergenic
956921299 3:73932463-73932485 AATGTGCTCTCCCTTCCCATTGG - Intergenic
957907713 3:86578961-86578983 ACTGTGCTCTCCCTCCCCAAAGG + Intergenic
960507285 3:118509163-118509185 AGTCTGCACTCCTTTCCCAATGG + Intergenic
960650181 3:119939283-119939305 ACTCATCTCTCCTTTCTCACAGG - Intronic
961382162 3:126501948-126501970 GCTCTGCTCACGGTTCCCACAGG - Exonic
961451550 3:127004514-127004536 ACTCTGCTCTCCTTAGGCCCGGG - Intronic
961639725 3:128357655-128357677 ACTCTGGTTTCCCCTCCCACAGG - Intronic
962151996 3:132902975-132902997 ACTCTTCCCTCCTTTTCCAAAGG - Intergenic
962674455 3:137744455-137744477 CCTCTCCTCTCCTCTCTCACAGG + Intergenic
963121558 3:141781004-141781026 ACTTTGCTCTCCTCTCACAGGGG + Intronic
965836522 3:172859465-172859487 ACTCTGGTCTCCTTTACCCATGG + Intergenic
966047990 3:175576521-175576543 ATTCTCCTCTCCTTGCCCAAAGG + Intronic
966457429 3:180133676-180133698 CTTCCGCTCTCCTTTCTCACTGG + Intergenic
967455878 3:189686141-189686163 TCTGTGCTTTCCTTTCCCTCCGG - Intronic
968743377 4:2342838-2342860 CCACTTCTCTCCTTTCCCATTGG - Intronic
968990127 4:3905129-3905151 ACTTTGCTTTCCTCCCCCACTGG - Intergenic
969026537 4:4177641-4177663 ATTTTGCTTTCCTCTCCCACTGG - Intergenic
969452476 4:7282613-7282635 GCTGTGCTATCCTTTCCCACCGG - Intronic
969458978 4:7317609-7317631 AGTCTGCCTTCCTGTCCCACTGG + Intronic
969582433 4:8073005-8073027 CCTCTCCTCTCCCTTCGCACCGG - Intronic
969595781 4:8148644-8148666 ACTCTGCTGTGCATGCCCACGGG - Intronic
969656730 4:8503081-8503103 ACCCTGGGCTGCTTTCCCACTGG + Intergenic
969841846 4:9888656-9888678 TCTTTCCTTTCCTTTCCCACTGG - Intronic
971925967 4:33010014-33010036 TCTCTGCTCCCCTTTCCCACTGG - Intergenic
972021684 4:34323525-34323547 ACTCTTCCCTCCCTTCTCACAGG - Intergenic
972789296 4:42355442-42355464 ACCCTGCTCCCCTTTCCTCCTGG - Intergenic
973197449 4:47462425-47462447 CCTCAGCTCTTCTTTCCCCCTGG - Intronic
973657580 4:53065313-53065335 TCTCTGTTATCCTTTCCCCCAGG - Intronic
975409519 4:74033056-74033078 GCTCTCCTCTCCCTGCCCACAGG - Intergenic
976988479 4:91332353-91332375 ACTTTGATCTATTTTCCCACAGG - Intronic
978095232 4:104768458-104768480 ACTCCCCTCTTCTTTCCCACAGG + Intergenic
978271401 4:106894145-106894167 AGTCTGGGCTCCTCTCCCACTGG - Intergenic
979413522 4:120407192-120407214 ACTCTTCTCTCCCTTTCCAAAGG - Intergenic
981364748 4:143889381-143889403 ACTCTGCTCTCCTTTCCCACTGG - Intronic
981375248 4:144007652-144007674 ACTCTGCTCTCCTTTCCCACTGG - Intronic
981385864 4:144129853-144129875 ACTCTGCTCTCCTTTCCCACTGG - Intronic
982456464 4:155615334-155615356 AAACTGCACTCCTTTCCCACTGG - Intergenic
982625611 4:157762217-157762239 ACTCTCTTCTCCTTTCCATCTGG - Intergenic
982966689 4:161917807-161917829 ACTCAACTCTCCTTTCCCAATGG + Intronic
983634265 4:169881951-169881973 ACTCTGCCCTCCTATACCTCTGG - Intergenic
983646034 4:169992309-169992331 TCTCTTCTCTCCCTTCCGACAGG - Exonic
983696201 4:170534825-170534847 ACTCTACTCTCCTTCTCCACTGG - Intergenic
984082170 4:175260763-175260785 ACTCTTCTCTGCTGTCCCCCTGG - Intergenic
984570937 4:181392684-181392706 AATCAGCTTTCCCTTCCCACTGG + Intergenic
985034129 4:185821120-185821142 CCTCTGCTCCCCTTGCCCCCCGG - Intronic
986179855 5:5383500-5383522 ACTCACCTTTCCTTTCCCAGTGG + Intergenic
988291552 5:29295247-29295269 AGTCTCCTCTCTTTTCCCAGAGG + Intergenic
989293838 5:39800367-39800389 TCTCTGCTCACATTTCTCACAGG - Intergenic
993893445 5:93502988-93503010 CCTTTTCTCTCCTTTCCCATAGG - Intergenic
996269457 5:121585354-121585376 ACTCTGTCCTCCATGCCCACTGG + Intergenic
996688459 5:126310782-126310804 TCTCTGCTCTCGCTTCCAACAGG + Intergenic
997079897 5:130725959-130725981 AGTCTGCTCTCCTTCCTCAGGGG - Intergenic
997352520 5:133241112-133241134 TCTCTGTTCTCCTCTCCCAGTGG - Intronic
997712204 5:136015295-136015317 ACTCTGCTCTTGTAGCCCACAGG + Intergenic
998549739 5:143065852-143065874 ACTCAGCTCCCTTCTCCCACTGG - Intronic
999517809 5:152318553-152318575 ACCCTTCACTCCTTTACCACAGG + Intergenic
999642507 5:153686068-153686090 ACTCTTCACTCCCTTGCCACAGG - Intronic
999881277 5:155867259-155867281 ATTCTTCTCTCCTTTCACTCTGG - Intergenic
1000791775 5:165616839-165616861 TCTCTGTTCTCCTTTGCCCCAGG - Intergenic
1001303204 5:170552917-170552939 ACTCAGCCCTCCTCTCCCGCAGG + Intronic
1001517806 5:172368174-172368196 CCTTTGCTCTCCTTTCCTTCAGG + Intronic
1002258631 5:177978586-177978608 CGTCTGCTCTCCAGTCCCACAGG - Intergenic
1002495775 5:179610499-179610521 ACCCTACCCTCCCTTCCCACGGG + Intergenic
1002501230 5:179648960-179648982 CGTCTGCTCTCCAGTCCCACAGG + Intergenic
1003194679 6:3904127-3904149 CCTCTGCTCTCCTTGCCGGCAGG - Intergenic
1003460042 6:6320713-6320735 ACCCTCCTCCCCTGTCCCACAGG + Exonic
1003476971 6:6492286-6492308 ACTCTGTTCTCATTTCCCAGAGG - Intergenic
1006135765 6:31895877-31895899 GCCCTCATCTCCTTTCCCACTGG + Intronic
1006353034 6:33535322-33535344 AGTCAGCTCTCCCTTCCCACTGG - Intergenic
1007172377 6:39872865-39872887 ATTTTGCTCTCCTCTCCCCCTGG + Intronic
1007399611 6:41596342-41596364 GCTCTCCTCTCCTTACCCAGGGG - Intronic
1008177563 6:48287840-48287862 ACTCTTCCCTCCCTTTCCACAGG + Intergenic
1010768869 6:79805913-79805935 CCTGTCCTCTCCTTTCCCACTGG + Intergenic
1011778344 6:90758371-90758393 ACTCTGCAATCCATTCCCTCAGG - Intergenic
1011779711 6:90773656-90773678 ACCCTGCTCTCCTATTCCATTGG + Intergenic
1013246059 6:108288654-108288676 ACTCTGGTCTCCTGTTCAACTGG - Intergenic
1013823625 6:114184777-114184799 ACTCTGCCCTCCAGACCCACTGG - Intronic
1014825593 6:126045981-126046003 CCTCTTCTATCCCTTCCCACAGG - Intergenic
1015062665 6:128985704-128985726 CAACTGTTCTCCTTTCCCACTGG + Intronic
1016320466 6:142838926-142838948 ACTATGCTCTCATTTCTAACTGG + Intronic
1016918510 6:149267125-149267147 TCTCTCCTCTCCATTCTCACAGG - Intronic
1017511438 6:155118034-155118056 ACTGTGGACTCCTTTCCCAGAGG + Intronic
1018987688 6:168650001-168650023 ACACCACTCTCCTCTCCCACCGG - Intronic
1019502728 7:1372925-1372947 CCTCCGCTCTCCTTCCTCACTGG - Intergenic
1019770333 7:2880453-2880475 ACTCTCCTCTCTGTTCCCAGAGG - Intergenic
1019805133 7:3117990-3118012 TCTCTGCTCCCCTTGCACACGGG + Intergenic
1021861805 7:24913375-24913397 ACTCTCTTCTCCTGTCCCTCAGG + Intronic
1023062624 7:36343323-36343345 CCTCTCCTCTCCTCTCCTACAGG - Intronic
1023508140 7:40921604-40921626 ACTGGGCTCTTCTTTGCCACTGG - Intergenic
1023570333 7:41565311-41565333 CCTCTCCTGTCGTTTCCCACAGG + Intergenic
1023810624 7:43908497-43908519 TCTCTGATCTCCCTCCCCACTGG + Intronic
1024043946 7:45574948-45574970 GCTCTGCTGTCCTTTCGCGCTGG + Exonic
1024143597 7:46487442-46487464 ACTCTGCTCTTCTTACCTGCCGG + Intergenic
1024300652 7:47885089-47885111 CCTCAGCCCTCCTTTCCCAGAGG + Intronic
1024579531 7:50790924-50790946 ACTCTGCTCTCTTCTCCTACTGG + Intronic
1024846608 7:53651610-53651632 ATTAAGCTCTCCTCTCCCACTGG + Intergenic
1026601537 7:71781646-71781668 AGCCTGCTCTTCTATCCCACTGG + Exonic
1026607258 7:71826704-71826726 CCTCTGATCTCATTTCCTACAGG + Intronic
1026988556 7:74570012-74570034 ACTCAGCTCTTCTTACCCAAAGG - Intronic
1027685541 7:81275774-81275796 TCGCTGCTTTCCATTCCCACTGG - Intergenic
1029617183 7:101666289-101666311 CCTCTCTTCTCCCTTCCCACAGG + Intergenic
1029707711 7:102284586-102284608 TCTGTGCTCCCCTTTCCCATGGG + Intergenic
1029960431 7:104684631-104684653 GCTCTGGTCTTCTGTCCCACTGG + Intronic
1030213246 7:107017377-107017399 ACTCCTCTCTCCTTTCTCATAGG - Intergenic
1030781868 7:113610769-113610791 ACTATGCTCTTATTTTCCACAGG - Intergenic
1032780307 7:135160436-135160458 ACTCTTCTCTACTTCCCCATGGG - Intronic
1033632120 7:143169080-143169102 ACTATTTTCTCCTATCCCACAGG - Intergenic
1033757908 7:144410723-144410745 GCTCTGCTCTCCTTTTCCTTAGG - Intergenic
1034338474 7:150338206-150338228 GCTCTGCTCACCCTGCCCACAGG + Intergenic
1034470918 7:151253939-151253961 ACTCTCCTCTCCTCTCCCTCCGG + Intronic
1034705617 7:153140259-153140281 ACGCTGCTCTCCTGTCCGAGTGG + Intergenic
1036112161 8:5915143-5915165 AGTGTGCTCTCTTTACCCACTGG - Intergenic
1036495396 8:9265707-9265729 ACACTGCGCGCCTTTCCAACAGG - Intergenic
1037777489 8:21845162-21845184 GTCCTGCTCTCCTTTCCCAAAGG - Intergenic
1039845314 8:41321611-41321633 CCTCTGCTCTCCAGCCCCACCGG - Intergenic
1041622737 8:59990861-59990883 ACTTTTCTCTCCTTTCCCTAAGG + Intergenic
1041691773 8:60694406-60694428 ACTGTGCTATCCTGTTCCACAGG - Intronic
1043078665 8:75736093-75736115 CCTCTGTTCTCCTGTACCACTGG - Intergenic
1044080018 8:87872327-87872349 CCCCTCCTCTCCTCTCCCACTGG + Exonic
1044275370 8:90293161-90293183 TCTCTTCGCTCCTTTCACACTGG + Intergenic
1045175671 8:99722071-99722093 ACTCTGCTCACCTCTCCAACTGG + Intronic
1046510344 8:115194244-115194266 GCTCTGCTCTCCTCTCTCAGGGG - Intergenic
1048200965 8:132373700-132373722 TCTTTGCTCTTCTCTCCCACTGG + Intronic
1048209936 8:132446419-132446441 ACTCTGCTCTCCTTGGCTGCTGG + Intronic
1048568017 8:135624275-135624297 TCTCTGCTCCCTTTGCCCACTGG - Intronic
1048886611 8:138914395-138914417 ACTCTGCTCCCTTTTCCAGCGGG + Intergenic
1049022397 8:139966386-139966408 ACCCTGCTCTCTGCTCCCACAGG + Intronic
1049534196 8:143170501-143170523 ACTCCCCTCCCCTTTCACACAGG + Intergenic
1050379240 9:5009217-5009239 ATCGTTCTCTCCTTTCCCACAGG - Intronic
1052188686 9:25630336-25630358 ATTCTGCTCTCCTTTCTGCCTGG - Intergenic
1053117776 9:35520572-35520594 ACTCTGCTCCCCCACCCCACAGG - Intronic
1053576050 9:39358015-39358037 ACTCTGCCCTCCGGCCCCACCGG + Intronic
1053840565 9:42185952-42185974 ACTCTGCCCTCCGGCCCCACCGG + Intronic
1054097621 9:60916706-60916728 ACTCTGCCCTCCGGCCCCACCGG + Intergenic
1054119023 9:61192336-61192358 ACTCTGCCCTCCGGCCCCACCGG + Intronic
1054452341 9:65409905-65409927 ACTCTGCTCCACTGTCCCACGGG + Intergenic
1054588729 9:66990226-66990248 ACTCTGCCCTCCGGCCCCACCGG - Intergenic
1055511596 9:77000533-77000555 ACTGTGCTATCCTGTGCCACTGG - Intergenic
1056244678 9:84682503-84682525 ACTATGCTCTGCTTTACCAAAGG - Intronic
1056655877 9:88508712-88508734 ACACTGCTGGCCTCTCCCACTGG + Intergenic
1057241630 9:93416788-93416810 ACTGTGCTGCCCTTTCCCCCAGG + Intergenic
1057545013 9:96012404-96012426 GCGCTGCTCTCCTTTCTCAAAGG - Intronic
1057743782 9:97735282-97735304 CCTCTTCTCTCCCCTCCCACAGG - Intergenic
1058886968 9:109329175-109329197 ACTCTGCTTTTCATTCCCAAGGG + Intergenic
1061787000 9:133035347-133035369 ACCCTGGACTCCTTTCCCCCAGG + Intronic
1062142945 9:134969820-134969842 ACCCTGCTCCCCTCTCCCATAGG + Intergenic
1186344025 X:8672590-8672612 TCCCTGCTCTCCTATCCCAGGGG - Intronic
1188934164 X:36153342-36153364 ACTCTGTTCTCCAGGCCCACTGG + Intergenic
1189544594 X:42028416-42028438 CATCTGATCTCCTTTCCCATAGG - Intergenic
1191943609 X:66505153-66505175 ACTCTTCCCTCCCTTTCCACAGG - Intergenic
1192400306 X:70827651-70827673 ACTCTTCCCTCCCTTTCCACAGG - Intronic
1192817377 X:74608652-74608674 TCTCTGCTGTCCTTTTCAACTGG - Intronic
1195884506 X:109625052-109625074 ACGCTGCTGACCTTTCCCCCTGG + Exonic
1197295869 X:124718334-124718356 ACTCTGGTCTCCTTTGCTATAGG + Intronic
1197698443 X:129576255-129576277 ACTCTTTTTTGCTTTCCCACTGG + Intronic
1198115690 X:133542808-133542830 ACTCTGCTGGCTGTTCCCACAGG + Intronic
1198381795 X:136090987-136091009 AGCCTGCTCTCCCTTCCCAAGGG - Intergenic
1198523099 X:137472613-137472635 ACTCTGCTGTCCTATCACACTGG + Intergenic
1199072296 X:143491541-143491563 AGGCTGCTCCCCTTTCCCTCTGG + Intergenic
1199285556 X:146050533-146050555 ACGCTGCACTGATTTCCCACTGG + Intergenic
1199328584 X:146531411-146531433 GATCTGCTCTCCTTTACCCCAGG - Intergenic
1199861737 X:151807078-151807100 TCTCTGCTCTCCTTTCCAAAGGG + Intergenic
1200009731 X:153111995-153112017 ACTCCTCTCTGCTCTCCCACTGG - Intergenic
1200029869 X:153287927-153287949 ACTCCTCTCTGCTCTCCCACTGG + Intergenic