ID: 981385868

View in Genome Browser
Species Human (GRCh38)
Location 4:144129884-144129906
Sequence TGGCTTTGCCACCAAATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981385864_981385868 8 Left 981385864 4:144129853-144129875 CCAGTGGGAAAGGAGAGCAGAGT 0: 3
1: 0
2: 3
3: 38
4: 333
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data
981385862_981385868 16 Left 981385862 4:144129845-144129867 CCACTGTCCCAGTGGGAAAGGAG 0: 3
1: 0
2: 2
3: 26
4: 286
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data
981385863_981385868 9 Left 981385863 4:144129852-144129874 CCCAGTGGGAAAGGAGAGCAGAG 0: 3
1: 1
2: 6
3: 51
4: 428
Right 981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981385868 Original CRISPR TGGCTTTGCCACCAAATGGT TGG Intronic
No off target data available for this crispr