ID: 981391464

View in Genome Browser
Species Human (GRCh38)
Location 4:144196361-144196383
Sequence CAAAATGCTGATAGTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981391462_981391464 4 Left 981391462 4:144196334-144196356 CCTAGAGACTTGTTAAATTGTTG No data
Right 981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981391464 Original CRISPR CAAAATGCTGATAGTGATAC AGG Intergenic