ID: 981392400

View in Genome Browser
Species Human (GRCh38)
Location 4:144206670-144206692
Sequence CTGGTTCTGTTCTCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981392400_981392408 29 Left 981392400 4:144206670-144206692 CCAGCCACAGAGAACAGAACCAG No data
Right 981392408 4:144206722-144206744 CTCTGTGTGGGTCCTTGCACTGG No data
981392400_981392406 16 Left 981392400 4:144206670-144206692 CCAGCCACAGAGAACAGAACCAG No data
Right 981392406 4:144206709-144206731 CAGTGACTAAACACTCTGTGTGG No data
981392400_981392407 17 Left 981392400 4:144206670-144206692 CCAGCCACAGAGAACAGAACCAG No data
Right 981392407 4:144206710-144206732 AGTGACTAAACACTCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981392400 Original CRISPR CTGGTTCTGTTCTCTGTGGC TGG (reversed) Intergenic
No off target data available for this crispr