ID: 981396398

View in Genome Browser
Species Human (GRCh38)
Location 4:144254750-144254772
Sequence AGAAAACAGCCAATGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981396398_981396400 7 Left 981396398 4:144254750-144254772 CCTGCCATCATTGGCTGTTTTCT No data
Right 981396400 4:144254780-144254802 GTTCTAGAATTATGTATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981396398 Original CRISPR AGAAAACAGCCAATGATGGC AGG (reversed) Intergenic
No off target data available for this crispr