ID: 981397275

View in Genome Browser
Species Human (GRCh38)
Location 4:144267708-144267730
Sequence TTGTAACACTTTAATAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981397274_981397275 22 Left 981397274 4:144267663-144267685 CCTGGATAAAAGTTATACTATGA No data
Right 981397275 4:144267708-144267730 TTGTAACACTTTAATAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981397275 Original CRISPR TTGTAACACTTTAATAATGA AGG Intergenic
No off target data available for this crispr