ID: 981398209

View in Genome Browser
Species Human (GRCh38)
Location 4:144279634-144279656
Sequence TGCACTCATGTCCCTTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981398206_981398209 -4 Left 981398206 4:144279615-144279637 CCCGAACAAGATAATGTCCTGCA No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398201_981398209 30 Left 981398201 4:144279581-144279603 CCAGTCTAAGTGCCAGCCATCAT No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398205_981398209 -3 Left 981398205 4:144279614-144279636 CCCCGAACAAGATAATGTCCTGC No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398204_981398209 4 Left 981398204 4:144279607-144279629 CCATGCTCCCCGAACAAGATAAT No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398203_981398209 14 Left 981398203 4:144279597-144279619 CCATCATTCTCCATGCTCCCCGA No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398207_981398209 -5 Left 981398207 4:144279616-144279638 CCGAACAAGATAATGTCCTGCAC No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data
981398202_981398209 18 Left 981398202 4:144279593-144279615 CCAGCCATCATTCTCCATGCTCC No data
Right 981398209 4:144279634-144279656 TGCACTCATGTCCCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981398209 Original CRISPR TGCACTCATGTCCCTTCTCA TGG Intergenic
No off target data available for this crispr