ID: 981401077

View in Genome Browser
Species Human (GRCh38)
Location 4:144314180-144314202
Sequence TCCTGAACAAACACTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981401077_981401088 24 Left 981401077 4:144314180-144314202 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401088 4:144314227-144314249 CCACAGTTGGGATACTCCAGTGG No data
981401077_981401084 12 Left 981401077 4:144314180-144314202 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401084 4:144314215-144314237 CCTTTCCCACTTCCACAGTTGGG 0: 65
1: 141
2: 206
3: 188
4: 307
981401077_981401089 25 Left 981401077 4:144314180-144314202 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401089 4:144314228-144314250 CACAGTTGGGATACTCCAGTGGG No data
981401077_981401082 11 Left 981401077 4:144314180-144314202 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401082 4:144314214-144314236 CCCTTTCCCACTTCCACAGTTGG 0: 32
1: 75
2: 107
3: 121
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981401077 Original CRISPR TCCTGAACAAACACTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr