ID: 981401091

View in Genome Browser
Species Human (GRCh38)
Location 4:144314243-144314265
Sequence TCCTGAACAAACACTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981401091_981401099 13 Left 981401091 4:144314243-144314265 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401099 4:144314279-144314301 CTTTCCCACTTCCACAGTTGGGG 0: 31
1: 108
2: 170
3: 196
4: 383
981401091_981401098 12 Left 981401091 4:144314243-144314265 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401098 4:144314278-144314300 CCTTTCCCACTTCCACAGTTGGG 0: 65
1: 141
2: 206
3: 188
4: 307
981401091_981401096 11 Left 981401091 4:144314243-144314265 CCAGTGGGAGTGTTTGTTCAGGA No data
Right 981401096 4:144314277-144314299 CCCTTTCCCACTTCCACAGTTGG 0: 32
1: 75
2: 107
3: 121
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981401091 Original CRISPR TCCTGAACAAACACTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr