ID: 981417924

View in Genome Browser
Species Human (GRCh38)
Location 4:144514915-144514937
Sequence TTCTCAGCAAAATTCCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981417924_981417927 13 Left 981417924 4:144514915-144514937 CCATTTTGGAATTTTGCTGAGAA No data
Right 981417927 4:144514951-144514973 TTCCTGTGTGCCTGGCTAAGTGG No data
981417924_981417926 5 Left 981417924 4:144514915-144514937 CCATTTTGGAATTTTGCTGAGAA No data
Right 981417926 4:144514943-144514965 GATTAGCATTCCTGTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981417924 Original CRISPR TTCTCAGCAAAATTCCAAAA TGG (reversed) Intergenic
No off target data available for this crispr