ID: 981417926

View in Genome Browser
Species Human (GRCh38)
Location 4:144514943-144514965
Sequence GATTAGCATTCCTGTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981417924_981417926 5 Left 981417924 4:144514915-144514937 CCATTTTGGAATTTTGCTGAGAA No data
Right 981417926 4:144514943-144514965 GATTAGCATTCCTGTGTGCCTGG No data
981417923_981417926 14 Left 981417923 4:144514906-144514928 CCAGCAGAGCCATTTTGGAATTT No data
Right 981417926 4:144514943-144514965 GATTAGCATTCCTGTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981417926 Original CRISPR GATTAGCATTCCTGTGTGCC TGG Intergenic
No off target data available for this crispr