ID: 981419060

View in Genome Browser
Species Human (GRCh38)
Location 4:144528116-144528138
Sequence CAATGCCAGTGTACCGTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981419058_981419060 5 Left 981419058 4:144528088-144528110 CCTAATCAGTAATAAAGAGAAAT No data
Right 981419060 4:144528116-144528138 CAATGCCAGTGTACCGTTTATGG No data
981419057_981419060 17 Left 981419057 4:144528076-144528098 CCTAATCAGTTTCCTAATCAGTA No data
Right 981419060 4:144528116-144528138 CAATGCCAGTGTACCGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981419060 Original CRISPR CAATGCCAGTGTACCGTTTA TGG Intergenic
No off target data available for this crispr