ID: 981419726

View in Genome Browser
Species Human (GRCh38)
Location 4:144535306-144535328
Sequence ATGAAGAAAAGGTGTGCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981419722_981419726 15 Left 981419722 4:144535268-144535290 CCCGACTATATTGTTTGGATTGT No data
Right 981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG No data
981419721_981419726 16 Left 981419721 4:144535267-144535289 CCCCGACTATATTGTTTGGATTG No data
Right 981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG No data
981419720_981419726 17 Left 981419720 4:144535266-144535288 CCCCCGACTATATTGTTTGGATT No data
Right 981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG No data
981419719_981419726 18 Left 981419719 4:144535265-144535287 CCCCCCGACTATATTGTTTGGAT No data
Right 981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG No data
981419723_981419726 14 Left 981419723 4:144535269-144535291 CCGACTATATTGTTTGGATTGTT No data
Right 981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981419726 Original CRISPR ATGAAGAAAAGGTGTGCTAA GGG Intergenic
No off target data available for this crispr