ID: 981423531

View in Genome Browser
Species Human (GRCh38)
Location 4:144578321-144578343
Sequence AGTTTCCTGAAGTGGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981423531_981423536 24 Left 981423531 4:144578321-144578343 CCAAGAAGCCACTTCAGGAAACT No data
Right 981423536 4:144578368-144578390 CTATCAAGAAAGGGAACTGCTGG No data
981423531_981423534 15 Left 981423531 4:144578321-144578343 CCAAGAAGCCACTTCAGGAAACT No data
Right 981423534 4:144578359-144578381 CTAGCTCACCTATCAAGAAAGGG No data
981423531_981423533 14 Left 981423531 4:144578321-144578343 CCAAGAAGCCACTTCAGGAAACT No data
Right 981423533 4:144578358-144578380 GCTAGCTCACCTATCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981423531 Original CRISPR AGTTTCCTGAAGTGGCTTCT TGG (reversed) Intergenic
No off target data available for this crispr