ID: 981424673

View in Genome Browser
Species Human (GRCh38)
Location 4:144589444-144589466
Sequence GTGGACATTAGTAAGACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981424665_981424673 8 Left 981424665 4:144589413-144589435 CCCAGCCATCCCCTCTGCAGCGA No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data
981424668_981424673 3 Left 981424668 4:144589418-144589440 CCATCCCCTCTGCAGCGAAGGCA No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data
981424671_981424673 -3 Left 981424671 4:144589424-144589446 CCTCTGCAGCGAAGGCATCTGTG No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data
981424670_981424673 -2 Left 981424670 4:144589423-144589445 CCCTCTGCAGCGAAGGCATCTGT No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data
981424666_981424673 7 Left 981424666 4:144589414-144589436 CCAGCCATCCCCTCTGCAGCGAA No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data
981424669_981424673 -1 Left 981424669 4:144589422-144589444 CCCCTCTGCAGCGAAGGCATCTG No data
Right 981424673 4:144589444-144589466 GTGGACATTAGTAAGACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981424673 Original CRISPR GTGGACATTAGTAAGACTGC TGG Intergenic
No off target data available for this crispr