ID: 981429188

View in Genome Browser
Species Human (GRCh38)
Location 4:144640902-144640924
Sequence CTATCTACACAGCTCTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981429184_981429188 -7 Left 981429184 4:144640886-144640908 CCGCTAGGCAGCAACCCTATCTA No data
Right 981429188 4:144640902-144640924 CTATCTACACAGCTCTACAAGGG No data
981429183_981429188 -6 Left 981429183 4:144640885-144640907 CCCGCTAGGCAGCAACCCTATCT No data
Right 981429188 4:144640902-144640924 CTATCTACACAGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981429188 Original CRISPR CTATCTACACAGCTCTACAA GGG Intergenic
No off target data available for this crispr