ID: 981429556

View in Genome Browser
Species Human (GRCh38)
Location 4:144644731-144644753
Sequence ATAAGGCAGTTGTCCCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981429556_981429560 3 Left 981429556 4:144644731-144644753 CCAAAATGGGACAACTGCCTTAT No data
Right 981429560 4:144644757-144644779 CTCATCAAAGCCCATCTTCTGGG No data
981429556_981429559 2 Left 981429556 4:144644731-144644753 CCAAAATGGGACAACTGCCTTAT No data
Right 981429559 4:144644756-144644778 CCTCATCAAAGCCCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981429556 Original CRISPR ATAAGGCAGTTGTCCCATTT TGG (reversed) Intergenic
No off target data available for this crispr