ID: 981432026

View in Genome Browser
Species Human (GRCh38)
Location 4:144672373-144672395
Sequence TCTTGAATGTACAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981432026 Original CRISPR TCTTGAATGTACAGGGAAAC AGG Intronic
904909207 1:33921538-33921560 TCTTGACTGTACTGGGGAAAGGG + Intronic
905374213 1:37507402-37507424 TCTAGAATGTAGAGCTAAACTGG - Intronic
907279944 1:53340765-53340787 TCCTCATTTTACAGGGAAACTGG - Intergenic
907662763 1:56408206-56408228 TGTTGAAGGTGCAGGGAAACAGG + Intergenic
909595331 1:77399885-77399907 GCTTAAAGCTACAGGGAAACTGG - Intronic
909734592 1:78941677-78941699 ACTTAAATGTCCAGTGAAACTGG + Intronic
910732520 1:90413379-90413401 TCATGCATGTACAAGGACACTGG + Intergenic
911870820 1:103096001-103096023 TGTGGAATGTTCAGGGAGACTGG + Intronic
912014914 1:105021120-105021142 TCTGGAATGAACATAGAAACAGG - Intergenic
913405446 1:118485960-118485982 TCTGGAATGTGCAAGGATACAGG + Intergenic
916439485 1:164808915-164808937 TCTTGACAGTTCTGGGAAACGGG + Intronic
920684442 1:208098645-208098667 TAATGAATTTGCAGGGAAACTGG + Intronic
920884462 1:209913088-209913110 CCTTGAAAGAACAGGGAAAAAGG - Intergenic
921443830 1:215221028-215221050 TTTTGACTGTGCAGGGAAAGGGG - Intronic
923962319 1:239099844-239099866 TCTGAAATGTATAGGTAAACTGG - Intergenic
924276046 1:242388324-242388346 TCCTGAATTTACAGTGAAATGGG + Intronic
924309961 1:242730781-242730803 TCTTGATATTACAGGGAAAGTGG + Intergenic
1065431880 10:25666811-25666833 CCTGTAATGTACAGGGAACCAGG + Intergenic
1066168131 10:32810202-32810224 TCTTGAATGTAAACAGAAAATGG + Intronic
1067229189 10:44395114-44395136 TCCTGAGTGTCAAGGGAAACAGG + Intergenic
1067340773 10:45401654-45401676 TCCTAAATGTCCAGGGAAGCTGG - Intronic
1067490502 10:46696033-46696055 TCTTTACTGTAAAGGGAAAGAGG - Intergenic
1073349572 10:102810190-102810212 TCTTGAAAGTACAGGAACAAGGG + Intronic
1074953666 10:118366060-118366082 TCATGAATGTAAAGGAAAATAGG + Intergenic
1076518884 10:131067187-131067209 TGTTGAAAGTACAGGAAAAAAGG + Intergenic
1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1078363797 11:10690848-10690870 TAGTGAATGTAAAAGGAAACGGG - Intronic
1081900384 11:46622576-46622598 GTTTGAATGTACAGAGAAAATGG - Intronic
1083122307 11:60526285-60526307 GATTGAATGTTCAGGGCAACTGG - Intronic
1088145687 11:106673669-106673691 TCTTGAAAGGACAGAGAAAAGGG - Intergenic
1097401230 12:59130364-59130386 TCTTGCATGTATTGGGAAAATGG + Intergenic
1097787222 12:63774125-63774147 TCTAAAATGTACAGGGAAATAGG + Intergenic
1105587674 13:21759972-21759994 TCTTAAATTTACATGGAAATTGG + Intergenic
1106232672 13:27833338-27833360 TCCTGCATGTACAGGGAACCAGG - Intergenic
1108718618 13:53106815-53106837 TCTTGAATGTATAGAGAAAAAGG + Intergenic
1109041197 13:57339186-57339208 TGTTAAATGTACAGAGAAAAAGG + Intergenic
1110562906 13:76928230-76928252 TTTTGAATGTCCAGGGACATTGG + Intergenic
1110790699 13:79583532-79583554 TCTTGTATATCCAGGGAAAGAGG - Intergenic
1110936415 13:81295757-81295779 TCTGCAATGTAAAGGAAAACAGG - Intergenic
1110953404 13:81522399-81522421 TCTTTACAGTTCAGGGAAACAGG - Intergenic
1111749885 13:92315407-92315429 TCTAGAGTGAACAGGGAGACTGG - Intronic
1118156388 14:63246337-63246359 TCTAGAGTGTTCAGGGAAATTGG + Intronic
1119552780 14:75527490-75527512 AGTTGAATTTACAGGGAGACAGG - Intronic
1120628869 14:86864450-86864472 TGTTGAAATTACATGGAAACAGG + Intergenic
1122004233 14:98688748-98688770 CCTTGAATGAACAGGGGAAGGGG + Intergenic
1202920398 14_KI270723v1_random:25974-25996 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1202924532 14_KI270724v1_random:11673-11695 TCTTGGGTGGACAGGCAAACAGG - Intergenic
1128796912 15:70472804-70472826 TCTTCAATGTAGAGGGAAGGAGG + Intergenic
1134890515 16:17837690-17837712 TTTTGCATGTACTGGCAAACAGG - Intergenic
1135189828 16:20345706-20345728 TCCTTAATGTACAGAGAATCAGG - Intronic
1136351369 16:29710406-29710428 TCTTTACAGTTCAGGGAAACAGG + Intergenic
1138017317 16:53440904-53440926 TGGTCACTGTACAGGGAAACAGG + Intronic
1139833269 16:69818065-69818087 TGTTGGAGATACAGGGAAACAGG - Intronic
1140193317 16:72836585-72836607 TCATGTATGTACACGGAAAAGGG + Intronic
1141224049 16:82098473-82098495 TCTTGAAATGAAAGGGAAACTGG + Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144709398 17:17390961-17390983 TCTGGAATGTACTGTGAAATGGG - Intergenic
1144969199 17:19096656-19096678 TTTTGAAGGGAGAGGGAAACAGG - Intronic
1144978717 17:19155410-19155432 TTTTGAAGGGAGAGGGAAACAGG + Intronic
1144989505 17:19222822-19222844 TTTTGAAGGGAGAGGGAAACAGG - Intronic
1145246400 17:21272690-21272712 GCTTGAATGGAGAAGGAAACAGG - Intergenic
1146112683 17:30104773-30104795 TCTGGAAAGGACAGGGAAACAGG + Intronic
1146974391 17:37098454-37098476 ACTCGCATGTACACGGAAACAGG - Intronic
1147571399 17:41573327-41573349 TCTTGAGGGTGGAGGGAAACTGG - Intergenic
1156591985 18:38500562-38500584 TGTTTAATGGACAAGGAAACTGG - Intergenic
1158001455 18:52623917-52623939 TATTGAATACACAGGGAAAGAGG + Intronic
1165265827 19:34663214-34663236 TCTTGACTGTTCTAGGAAACAGG - Intronic
1165561077 19:36680564-36680586 GAATGAATGTACAGGGAATCAGG - Intergenic
1165975411 19:39672047-39672069 TCTTTACAGTTCAGGGAAACAGG + Intergenic
1167813921 19:51861826-51861848 TCTCTAATGTACAGTGAGACAGG + Intronic
926759414 2:16264617-16264639 TCTTGAATGTACCTAGAAATGGG - Intergenic
927464870 2:23329364-23329386 TCTTTAATGGAAAGGGAAGCTGG + Intergenic
927924610 2:27002496-27002518 TTTTGAGGGTACAGGGAAATGGG - Intronic
928372922 2:30754205-30754227 TCGTAAATGTTCAGGGAAAAGGG + Intronic
931616717 2:64166783-64166805 TTTTGAGTGTACAGAGACACAGG - Intergenic
933546747 2:83723151-83723173 TCTACAATTTTCAGGGAAACTGG + Intergenic
935275650 2:101473876-101473898 TTTTGGATGTACATGGAAGCAGG + Intronic
938544687 2:132317127-132317149 TTTTGAATCTTCAGGGAAAGGGG + Intergenic
938703062 2:133896454-133896476 ACTTTAATGTACAGAAAAACTGG - Intergenic
941248594 2:163132785-163132807 TCTTGAGTATACTGGGAAAATGG + Intergenic
942110192 2:172674478-172674500 TCTTAAATGTACTGGGAGTCTGG + Intergenic
947916691 2:233836939-233836961 TCTCGAATGAAATGGGAAACAGG + Exonic
1171048678 20:21835077-21835099 TTTTGACTGTTCAGGGAAATAGG - Intergenic
1172398746 20:34630557-34630579 TTTTCACTGTACAGGGAATCAGG - Intronic
1172452364 20:35035493-35035515 TTTAGCAGGTACAGGGAAACAGG + Intronic
1173380934 20:42540472-42540494 TCTTGAAGGTAGAGTGAAAGTGG + Intronic
1174020249 20:47524279-47524301 TCTTTACAGTTCAGGGAAACAGG - Intronic
1179228459 21:39477680-39477702 TCTGGAAGGTACAGTGAAGCTGG - Intronic
1182838718 22:33366050-33366072 TTTTAAATGAAAAGGGAAACTGG - Intronic
1184461107 22:44638735-44638757 TCCTGAATGTACAGCCAAGCTGG + Intergenic
954189072 3:48943388-48943410 TCAGGAATGCACAGGGATACAGG - Intronic
955795304 3:62630181-62630203 TATTGAATGAATAAGGAAACAGG + Intronic
957081187 3:75637113-75637135 TCTTGGGTGGACAGGCAAACAGG - Intergenic
958523121 3:95217130-95217152 TCTTTAGTGAAAAGGGAAACTGG + Intergenic
959489436 3:106970570-106970592 ACTGGAATGGACAGGGAAATAGG - Intergenic
960008071 3:112802102-112802124 TGGTGAAAGTACAGGGAAATGGG - Intronic
960167290 3:114417737-114417759 TCTTTAATGTAAAGGAAAAAAGG + Intronic
960252108 3:115467270-115467292 TGCTGAAAGTACAGGGAAACTGG + Intergenic
960896510 3:122511971-122511993 TCTCAAATGTAAAGGGAAAAGGG + Intronic
962101898 3:132351388-132351410 TCTGGGATGAGCAGGGAAACAGG + Intronic
963783069 3:149506694-149506716 TCTTTAATCTACAGAGAACCAGG + Intergenic
964382366 3:156110292-156110314 TGTAGAATGTACTGCGAAACTGG - Intronic
970069735 4:12144125-12144147 TTTTGAAGGCAGAGGGAAACTGG - Intergenic
972947809 4:44279335-44279357 TCCTGAATGAACTGGGAAGCAGG - Intronic
973039555 4:45453460-45453482 TGTTGACTCAACAGGGAAACCGG - Intergenic
975874466 4:78819585-78819607 TGCTGAATGTATAAGGAAACTGG + Intronic
976528259 4:86118746-86118768 TTTTAAATGTAAAGGGAAAGAGG - Intronic
978531473 4:109719123-109719145 GTTAGAATGTACAGGAAAACAGG - Intronic
979216762 4:118174284-118174306 TTTTTAATGTTCTGGGAAACTGG - Intronic
980233643 4:130075782-130075804 TCTGGAATGTGGAAGGAAACAGG - Intergenic
981432026 4:144672373-144672395 TCTTGAATGTACAGGGAAACAGG + Intronic
981750905 4:148091624-148091646 ACATGAATGTACAGGGTGACTGG - Intronic
982558866 4:156903999-156904021 TTTTAAATTTACAGGGAACCTGG - Intronic
983861287 4:172710380-172710402 TCATGAATGTACAAGAAAAGAGG + Intronic
985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG + Intergenic
990890670 5:60646418-60646440 TATAGAATGTACAGGAAAAGGGG + Intronic
993670635 5:90757140-90757162 TCTTGAATTTGCAGATAAACAGG + Exonic
993711468 5:91229819-91229841 TTTTGAATGTACAGGCTCACAGG - Intergenic
997050133 5:130370740-130370762 CCATGAATGCACAGGGAACCTGG - Intergenic
1003203950 6:3990410-3990432 GCGTAAATGTACAGGGACACAGG - Intergenic
1003843584 6:10148653-10148675 TCTTAAATGTATAGGAAAAGAGG + Intronic
1005383183 6:25258768-25258790 ACTTAAATGTAAGGGGAAACTGG + Intergenic
1008721601 6:54360551-54360573 CCTTCAATGGACAGGGACACAGG - Intronic
1009616291 6:66011534-66011556 TCTTAAATGTCCAGAGAAAAGGG - Intergenic
1010213462 6:73381639-73381661 GCCTGAATGTCCAGGGAAAGAGG + Intronic
1011746814 6:90414427-90414449 TCCTAAATTTACAGGAAAACAGG + Intergenic
1013040250 6:106425936-106425958 TCATGAATTTAAAGTGAAACTGG - Intergenic
1013331277 6:109102880-109102902 TCTGGAATGTATCAGGAAACCGG + Intronic
1014969721 6:127799654-127799676 GCCTGAAAGTAGAGGGAAACTGG - Intronic
1016117891 6:140311355-140311377 TCTGGAATGTACAATAAAACAGG + Intergenic
1018034193 6:159867421-159867443 TCTTTAATGTGCAGTGAAGCCGG - Intergenic
1018209480 6:161467171-161467193 TTTTCAATGTACTGGGAAAGTGG + Intronic
1018775864 6:167015256-167015278 TCAGAAATGTACAGGGAAAAAGG - Intronic
1023493933 7:40773946-40773968 TGTTGAATGGACAGAGAAACAGG + Intronic
1027649962 7:80854314-80854336 TCATGAAGGTACAGGAAAAGGGG + Intronic
1029059721 7:97785009-97785031 TCCTGAATGTACAGGTTAAAAGG - Intergenic
1029229377 7:99053688-99053710 TCTTGGAAATACAGGGAACCAGG - Intronic
1030565007 7:111142580-111142602 TCGTGAATTTACAGGGATTCAGG + Intronic
1031163487 7:118197861-118197883 TCTTGACAGTACAAGGAAGCAGG - Intergenic
1031588460 7:123561366-123561388 TCTTGAATGAACAAAGAAAGTGG - Intergenic
1034013180 7:147553177-147553199 CCTAGATTGGACAGGGAAACGGG + Intronic
1038348680 8:26756514-26756536 TCATGAATGCAAAGGGAAAGAGG - Intronic
1041049324 8:53917512-53917534 TGTTAAATGTACATTGAAACTGG + Intronic
1042170696 8:65988269-65988291 TCTAGAATGCCCAGGGAAAATGG + Intergenic
1043981162 8:86641251-86641273 TCATGAATTTTCAGGGAAAGGGG - Intronic
1044035334 8:87296050-87296072 TCTAGAATATACAGAAAAACAGG - Intronic
1044793005 8:95866915-95866937 TTTTAAATCTACAGGAAAACTGG + Intergenic
1045551061 8:103172743-103172765 TCTCCATTTTACAGGGAAACTGG - Intronic
1048188891 8:132270300-132270322 TCTTGCATGTAGTTGGAAACTGG - Intronic
1050186918 9:2984373-2984395 TCTAGAATGTTCAGGTAAGCAGG - Intergenic
1050750889 9:8935816-8935838 TCTTGGATGGAAAGGGAAAGGGG - Intronic
1056245452 9:84690494-84690516 GCTTGAAAGAACAGGGAAAGAGG + Intronic
1056598818 9:88029949-88029971 TCTTTATTGTAAAGGAAAACTGG + Intergenic
1059110170 9:111550228-111550250 TTTTGAATGTCCAGAAAAACAGG + Intronic
1060082365 9:120661654-120661676 TCTTGATTGTAATGGGAAGCTGG - Intronic
1060319428 9:122542461-122542483 TGTTGAAAATACAGGGCAACTGG - Intergenic
1060848461 9:126856121-126856143 TCTGTAAGGTACAGGGAAAATGG + Intergenic
1186582734 X:10838431-10838453 TCTTGAATGCACTGGAAAATAGG + Intergenic
1188136712 X:26501440-26501462 TCTTGAAGGCAAAGAGAAACTGG - Intergenic
1189168707 X:38887955-38887977 TCTTGAATGATCAGGGAATGGGG - Intergenic
1196980450 X:121208365-121208387 TCTTCAATGTACAGAGACAGAGG - Intergenic
1197933601 X:131717914-131717936 TCTTGAATGTACACAAATACAGG + Intergenic
1199291352 X:146108133-146108155 TCTGGGATGTCCAGGGAAAATGG + Intergenic
1199320861 X:146437068-146437090 TCTTTAATGTACAGAAAAAAAGG - Intergenic
1200734872 Y:6783160-6783182 TCTGGAAAGGAAAGGGAAACAGG + Intergenic
1201771100 Y:17617768-17617790 TCTTGGGTGAACAGGCAAACAGG + Intergenic
1201830455 Y:18288218-18288240 TCTTGGGTGAACAGGCAAACAGG - Intergenic