ID: 981435655

View in Genome Browser
Species Human (GRCh38)
Location 4:144718471-144718493
Sequence TGAGATAAGAAGCTATTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981435655 Original CRISPR TGAGATAAGAAGCTATTGCA GGG Intronic
900867750 1:5280546-5280568 TGTGATAAGAAGCTTCTGGAAGG - Intergenic
903896173 1:26606631-26606653 TGAGATGAGAAGCCACTGGAGGG + Intergenic
905236410 1:36553147-36553169 GGAGCTAGAAAGCTATTGCAAGG - Intergenic
905343848 1:37298104-37298126 TGAGAGAGGAAGCCATTGGAGGG + Intergenic
906447845 1:45918761-45918783 TGAGATAAGTAGCCACTGGAAGG + Intronic
906677192 1:47701761-47701783 TCAGGTAAGAGGCTGTTGCAGGG - Intergenic
907615755 1:55924634-55924656 TGAGATAGGAAGCTACTGGCAGG + Intergenic
907827781 1:58035642-58035664 TGAGATAGCAAGATAGTGCATGG + Intronic
907866956 1:58407730-58407752 TCTGATAGGAAGATATTGCAGGG - Intronic
908308470 1:62850437-62850459 TGAGTTAAAAAGCTACTGTAAGG - Intronic
908724199 1:67157437-67157459 TGAGATGGGAAGCTGTTGAAGGG - Intronic
909107607 1:71432117-71432139 TGAGATAGGATGCTATTGAGTGG + Intronic
909362971 1:74786896-74786918 TGGGATAAGAAGGGATTGGAGGG - Intergenic
910218324 1:84864554-84864576 TGAGATGAGAAGCTATGGGAAGG - Intronic
910537155 1:88311352-88311374 GGAAATGAGAAACTATTGCAGGG - Intergenic
911529607 1:99029134-99029156 TGAGATGGGAAGCTATTGTTAGG + Intergenic
912015999 1:105036405-105036427 TCTGATATGAAGCTATTGAATGG - Intergenic
913161566 1:116150388-116150410 AGAGATGAGAAGCTATTGGGAGG - Intergenic
916386145 1:164272682-164272704 AGAGATAAGAATCTCTTTCAGGG + Intergenic
918519753 1:185403161-185403183 TGAGATGGGAAGTCATTGCAGGG + Intergenic
918994751 1:191743030-191743052 GGGGATAATAAGCTTTTGCAGGG - Intergenic
920612048 1:207450363-207450385 TGAGATAGGAAATTATTGGAGGG + Intergenic
922577474 1:226671937-226671959 TGAGATAGGAAGCTGCTGGAGGG + Intronic
923259058 1:232249473-232249495 TGCAATAGGAAGCTATTGGAGGG - Intergenic
924103643 1:240629314-240629336 TGATATAAAGAGCTGTTGCATGG - Intergenic
924758968 1:246966864-246966886 TGAGATGAGGAGTTATTGGAGGG + Intronic
1063514396 10:6680625-6680647 TGAGATAAAATGATATTGGAAGG + Intergenic
1064392986 10:14957575-14957597 TAAGATGGGAAGCCATTGCAGGG + Intergenic
1064499364 10:15952174-15952196 TTAGATAAGAGGCTGTTGCCTGG + Intergenic
1064691666 10:17924748-17924770 TGAGTTCAAAAGCTATTGCTGGG + Intergenic
1064786455 10:18902825-18902847 TTAGATAAGAGGCTTTGGCATGG + Intergenic
1064915065 10:20447790-20447812 TGAGATGAGAAGCCACTGAAGGG + Intergenic
1064932080 10:20639552-20639574 TGAGACAAGAAGCTATTGGAGGG + Intergenic
1065415721 10:25483187-25483209 TGAAATAGGGAGCTAATGCAGGG - Intronic
1065626977 10:27639644-27639666 TGAGATGGGAAGCCATTGGAAGG + Intergenic
1066263601 10:33753206-33753228 TGAGATAAGAATCTATTTCAGGG - Intergenic
1067126561 10:43521526-43521548 TGAAACAAGAAGCTAGAGCATGG + Intergenic
1067897874 10:50204153-50204175 TGAAATGAGAAGCTACTGGAGGG + Intronic
1069361423 10:67646932-67646954 TGAGAAAAGCAGCTATTTAAAGG - Intronic
1070431055 10:76338010-76338032 TAAGACAGGAAGCTATTTCAAGG + Intronic
1071882426 10:89913872-89913894 TGAGAGAAGAAGCTTTTGTAAGG - Intergenic
1073696930 10:105880039-105880061 TGATATAAAAAACTATTCCAGGG + Intergenic
1074459336 10:113622965-113622987 TGAGAGAAGAAGCTTGAGCAAGG - Intronic
1075638329 10:124045889-124045911 TGAGATCAGAAGCTCTTGGTGGG + Exonic
1076620964 10:131787814-131787836 TGTGATAAATAACTATTGCATGG - Intergenic
1077976844 11:7255410-7255432 TGAGATAGGAAGCCATTAGAAGG + Intronic
1078643277 11:13115533-13115555 TGAGATAAGAAGGCTTTGCATGG - Intergenic
1078683542 11:13504505-13504527 TGAGATAAAAAAATATTGCATGG + Intergenic
1078797724 11:14609801-14609823 TGAGATAGGAAGCCAGTGCAGGG + Intronic
1080044133 11:27790419-27790441 TGAGATAGGAAACTGTTGTAGGG + Intergenic
1080594073 11:33753202-33753224 TGAGGTGAGAAGTTAATGCAGGG - Intronic
1082857643 11:57823061-57823083 TGAGGTAAGAAGTCAATGCATGG + Intergenic
1083462324 11:62822381-62822403 TGACATAGGGAGCCATTGCAGGG - Intronic
1085799580 11:79576911-79576933 AGAGATAAGGAGCCATTCCATGG - Intergenic
1086284261 11:85227695-85227717 TGAGATGGGAAGCCATTGGAGGG - Intronic
1086846284 11:91753858-91753880 TGATTCAACAAGCTATTGCAAGG - Intergenic
1086857505 11:91883175-91883197 TGAAATGGGAAGCTATTGGAGGG - Intergenic
1092929761 12:13304875-13304897 TTTGATAAGAAGCTATGGGAGGG - Intergenic
1093241647 12:16684275-16684297 TGATACAGGAAGCTATTGAAGGG - Intergenic
1093471382 12:19505717-19505739 TGAGATGGGAAGCCATTGAAGGG + Intronic
1093754940 12:22842014-22842036 TAAAATGGGAAGCTATTGCAAGG - Intergenic
1095749012 12:45690409-45690431 TTAGAACAGAAGATATTGCATGG + Intergenic
1095966629 12:47871763-47871785 TGAGATAAGAAACCAGTGCCTGG - Intronic
1097342854 12:58458745-58458767 TGAGATTAAAAGCTATTTCTAGG + Intergenic
1099465602 12:82983345-82983367 TGAGATAAGAAAATATTAAAGGG - Intronic
1099567625 12:84273024-84273046 GGAGAAAAGAAACTATTTCAAGG + Intergenic
1100177635 12:92049312-92049334 TAGGATTAGAAGCTATTGAAAGG - Intronic
1100514560 12:95314559-95314581 TGAGATAGGAAGCCACTGAAGGG + Intergenic
1100667500 12:96770888-96770910 TGTGATAAGAAAGTATTGCCAGG + Intronic
1101289113 12:103348830-103348852 TGAGATAAGGAACAATTGCAAGG + Intronic
1101461672 12:104903309-104903331 TGAGATAAGAAACCAATGGAAGG - Intronic
1102091244 12:110190088-110190110 TGAGATAGGCAGCTGTTGAAAGG - Intronic
1102818600 12:115888751-115888773 TGAGACAAGCAGCTTTTGAAGGG - Intergenic
1103387849 12:120547794-120547816 AGAGATGAGAAGCCATTGAAAGG + Intronic
1104081103 12:125431126-125431148 TGGGATGAGCAGCTACTGCAGGG + Intronic
1104466731 12:128996588-128996610 TGAGAAACAAAGCTATTGAATGG + Intergenic
1106119860 13:26851220-26851242 TGTGATAAGATGCTTCTGCAAGG - Intergenic
1106353134 13:28954430-28954452 TGAGAGAAGAAACTAATGGAAGG - Intronic
1106381822 13:29246584-29246606 GGAGAAAAGAAGCCATAGCAAGG - Intronic
1107273817 13:38654067-38654089 TCAGATAATAAGTTATTGGAAGG - Intergenic
1108027994 13:46198802-46198824 GGAGGCAAGAAGCTATTGCAGGG + Intronic
1108036698 13:46297566-46297588 TGAGATAAGAAGATTATGCCAGG - Intergenic
1108139669 13:47406958-47406980 TCAGATAAAAAGCTGTTGGATGG + Intergenic
1108239451 13:48446878-48446900 TGTGACAGGAAGCTCTTGCAGGG + Intronic
1109217185 13:59603258-59603280 TGAGCTAAGTAGCTACAGCAAGG + Intergenic
1109681026 13:65752716-65752738 TGGGAGGAGAAGCTATTGGAAGG + Intergenic
1110545675 13:76752536-76752558 TAGGATAGGAAGCTATTACACGG - Intergenic
1110636207 13:77769270-77769292 TGAAACAGGAAGCTGTTGCATGG + Intergenic
1112604230 13:100888363-100888385 TGGGATGAGAATCTATTCCATGG + Intergenic
1114038570 14:18654452-18654474 AGAAATAAGAGGCTATTGTAGGG - Intergenic
1114120050 14:19660595-19660617 AGAAATAAGAGGCTATTGTAGGG + Intergenic
1114283742 14:21220128-21220150 TGAGATGGGAAGCTATTAGAGGG - Intronic
1114341118 14:21745730-21745752 TGAGAAAAGAAGAAATTGCAAGG + Intergenic
1114374894 14:22133744-22133766 AGAAATGGGAAGCTATTGCAAGG - Intergenic
1115129135 14:30032674-30032696 TGAAATGGGAAGCCATTGCAGGG - Intronic
1117402127 14:55367954-55367976 TGAGAAAAGAAGCTGGGGCATGG + Exonic
1117828734 14:59729325-59729347 TGAGATTAGAAGACATTGGAGGG + Intronic
1117967216 14:61218431-61218453 TGGGATAAGAAGCTTTGGTAAGG + Intronic
1118550743 14:66947028-66947050 TGTGATAAGAATCCATTGAAGGG - Intronic
1121303218 14:92888441-92888463 TGAGATAAGAAGCCATGGGAAGG + Intergenic
1202831389 14_GL000009v2_random:37329-37351 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1123471844 15:20561211-20561233 TGAAATAAGAAACTAGTGGATGG + Intergenic
1123646162 15:22439140-22439162 TGAAATAAGAAACTAGTGGATGG - Intergenic
1123732146 15:23156202-23156224 TGAAATAAGAAACTAGTGGATGG + Intergenic
1123750281 15:23353584-23353606 TGAAATAAGAAACTAGTGGATGG + Intergenic
1124055058 15:26234670-26234692 GGAGATAGGAAGCTATTGGAGGG - Intergenic
1124282650 15:28377500-28377522 TGAAATAAGAAACTAGTGGATGG + Intergenic
1124300052 15:28534110-28534132 TGAAATAAGAAACTAGTGGATGG - Intergenic
1124888216 15:33707129-33707151 TCAGATAAGAAGCAATGGAAAGG - Intronic
1124947662 15:34285106-34285128 TGAGATAAGAAGCCATTGAAAGG + Intronic
1125814495 15:42573308-42573330 TGAGATAAAAAGACATTTCAGGG - Intergenic
1126650080 15:50911269-50911291 TGAGATAGGAAGTTATGGAAAGG + Intronic
1128250256 15:66158891-66158913 AGAGTTTAGAAGCTACTGCATGG - Intronic
1129128784 15:73471044-73471066 TGAGATAGGGAGCTATTGCAGGG + Intronic
1129636960 15:77330439-77330461 TGAGATGAGAAGCCATTGTAGGG - Intronic
1130531622 15:84751015-84751037 TGAGATAAGCAGGTAAGGCAAGG + Intronic
1130934194 15:88455054-88455076 TGAGATACGAAGCTTCTCCAAGG + Intergenic
1131798643 15:96046709-96046731 TGAGATGAGAAGCTTGAGCAAGG + Intergenic
1132026440 15:98407934-98407956 GAAAATAAGAAGCTGTTGCATGG + Intergenic
1137016013 16:35376268-35376290 TGAGGTGAGAAGTTATTGGAGGG - Intergenic
1137994130 16:53190576-53190598 TGAGATAATAAGATATTCAATGG - Intronic
1138256059 16:55562178-55562200 TGAGATGAGACTCTATTGCTAGG - Intronic
1139189533 16:64845631-64845653 TGAAATAAGAAGCCAATGCAGGG - Intergenic
1141362911 16:83413267-83413289 TGAGATTTGAAGCTATTTTATGG - Intronic
1146418091 17:32655723-32655745 TGAGATGAGAAGCCATCGGAAGG + Intronic
1147502281 17:40976859-40976881 TGAGATAAAAAGCTAATCCAGGG + Intergenic
1149446758 17:56719340-56719362 ACAAATAAGAAGCTATTGGATGG + Intergenic
1150672893 17:67217529-67217551 TGAGTTGGGGAGCTATTGCAGGG - Intronic
1150898522 17:69241465-69241487 TGAGATCAGAAGTCATTGGAGGG - Intronic
1153528690 18:6021709-6021731 TGAGAATCGAAGCCATTGCATGG + Intronic
1154408945 18:14125042-14125064 TGTTATAAGAAGCTAATTCATGG - Intronic
1156891654 18:42197433-42197455 TGAGATAAAATCGTATTGCATGG - Intergenic
1158236862 18:55325358-55325380 TTAGATAACAAACTATTACAGGG + Intronic
1167030147 19:46953479-46953501 TGAGGTAAGAAGCCATTGAGGGG + Intronic
1202641311 1_KI270706v1_random:90416-90438 TGAGATAGGAATCTGTTGGAAGG - Intergenic
925802347 2:7613921-7613943 TGAGAGAGGAAGCCATTGTAGGG - Intergenic
927446362 2:23165537-23165559 CGTGATAAGAAGCTGTTGCAGGG + Intergenic
927729608 2:25459454-25459476 TGATATGAGAAGCTATTGAGAGG + Intronic
929005906 2:37392470-37392492 TGAGATAAGGAATTATTGCAGGG - Intergenic
929347936 2:40909276-40909298 TGACATAAGAAGCTACTGAATGG - Intergenic
929531986 2:42758490-42758512 TGAGTCAAGACACTATTGCAAGG - Intergenic
930254096 2:49069087-49069109 TGAGATGAGGAGCCATTGGAAGG - Intronic
930259144 2:49124830-49124852 TGAGGCAAGAAGCAATTGAAAGG - Intronic
931295794 2:60923892-60923914 TGAGATGAGAAGCCAATGAATGG - Exonic
932067060 2:68575450-68575472 TGAGACAGAAAGCTATTGGAAGG + Intronic
932914609 2:75842915-75842937 TGTGATATGAAGGTATTGGACGG + Intergenic
933058959 2:77711151-77711173 TCAGATAAGAAGATCATGCATGG - Intergenic
933456009 2:82520212-82520234 TGAGATAAGAAACTGTTACCAGG + Intergenic
934497119 2:94813840-94813862 TGAGATAGGAATCTGTTGGAAGG - Intergenic
935720912 2:105978465-105978487 AGAGCTATGAAGCTATTGCTGGG + Intergenic
937342353 2:121099363-121099385 TGAGATCAGAAGCCCTTTCATGG - Intergenic
938762174 2:134435920-134435942 GGAGAGAAGAAGCTATGACAGGG + Intronic
940818618 2:158326027-158326049 TGATATGAGAAGCTGTTGGAAGG - Intronic
940864151 2:158800462-158800484 TGACATAAGAACCTGGTGCATGG - Intronic
941735332 2:168968702-168968724 AGAGGTAACAAGCTATTGTATGG - Intronic
941736214 2:168979751-168979773 AAATATAAGAAGCTATCGCAAGG - Intronic
942421151 2:175809324-175809346 TGAGTTAAGAGGCAATTGCAAGG + Intergenic
942883760 2:180896725-180896747 TGAAATGGGAAGCCATTGCAAGG - Intergenic
943132767 2:183875708-183875730 AGAGATTAATAGCTATTGCATGG + Intergenic
943161007 2:184251414-184251436 TGAGATAGCAAGCCATTGAAGGG - Intergenic
943632652 2:190271629-190271651 TTATTTAGGAAGCTATTGCAGGG - Intronic
943673441 2:190691086-190691108 AAAGATAGGAAGCTATTGCTTGG + Exonic
944345497 2:198660393-198660415 AGAGATAAGAGGCTATTAAAGGG + Intergenic
944373928 2:199017900-199017922 TGAAATAGGAAGCCATTGGAAGG + Intergenic
945205624 2:207328948-207328970 TGAGATGGGAAGTTATTGGAGGG + Intergenic
945905569 2:215589007-215589029 TGATATAAAAATCTATCGCAAGG + Intergenic
946552597 2:220819562-220819584 TATGATCAGATGCTATTGCAAGG + Intergenic
948401779 2:237690798-237690820 GGAGAAAACAAGCTATTGAAAGG + Intronic
1168975562 20:1962979-1963001 TGAGACAAGAAGCTAGGGGAGGG - Intergenic
1169497405 20:6128580-6128602 TGGCATAAGTAGCTATTGAAGGG + Intergenic
1170069746 20:12353362-12353384 TGAGAAAAGCACCTATTGCAAGG + Intergenic
1170521251 20:17187825-17187847 TGCTATAAGAAGCTAATTCATGG + Intergenic
1171888420 20:30680626-30680648 TGAGATAGGAATCTGTTGGAAGG - Intergenic
1172518231 20:35550705-35550727 TGAGATGAGAAGCCATTGTAGGG + Intronic
1173243122 20:41315592-41315614 TAAGACAAAAAGCTATTGGAGGG + Intronic
1173384961 20:42578820-42578842 TGAAATGGGAAGCTGTTGCAGGG - Intronic
1174147331 20:48460884-48460906 TGAGGGAAGAAGCCATTGGAAGG + Intergenic
1176416937 21:6481375-6481397 TGAAATAACAAGCCACTGCAGGG + Intergenic
1176610576 21:8882160-8882182 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1177250814 21:18588061-18588083 TAAGATAAGAAGCTCTTTTAAGG + Intergenic
1177788938 21:25701007-25701029 TGACATCACAAGCTATTTCAAGG - Intronic
1178606856 21:34045146-34045168 TGTGATGAGAAACTATAGCAAGG - Intergenic
1179692435 21:43089708-43089730 TGAAATAACAAGCCACTGCAGGG + Intergenic
1180360648 22:11891461-11891483 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1180462697 22:15581490-15581512 AGAAATAAGAGGCTATTGTAGGG - Intergenic
949687889 3:6598860-6598882 TAACATAAGAAGCTATTGACAGG + Intergenic
951173824 3:19575944-19575966 TGAGATACGATTCTATTGCAGGG + Intergenic
951630582 3:24715879-24715901 TGAAATAAGAAGTGACTGCATGG - Intergenic
952635255 3:35521440-35521462 TGAAAGAAAAAGCTATTGCCTGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
954860210 3:53681850-53681872 TGGGACAAGAAGCTAGGGCAAGG + Intronic
954971617 3:54656263-54656285 TGAGATAAGAAAATAATGCAAGG - Intronic
955057344 3:55468089-55468111 TGAGATAAGAACATATTTGATGG + Exonic
957883820 3:86256648-86256670 TGAGATGGGAAGCCATTGGAGGG + Intergenic
959584409 3:108012883-108012905 TCAGATAAGAAGTTCTCGCAAGG + Intergenic
960025417 3:113003377-113003399 TGAGATTAGAAACTATTGTCAGG - Exonic
962768161 3:138586039-138586061 TGAGTTAAAAAGCTTCTGCACGG + Intronic
963036649 3:141035896-141035918 TGAGAAAAGGAGCTAATTCAGGG + Intergenic
963244841 3:143048166-143048188 ATAGTTAAGAAGCCATTGCATGG + Intronic
965074444 3:163958945-163958967 TGAGATTAGAAGTTTTTGAAAGG - Intergenic
965163081 3:165160227-165160249 TGAGATAAGAAGAAACTGAATGG - Intergenic
965429223 3:168566180-168566202 TGAGATGAGAAGTTGTTGTAGGG + Intergenic
966727062 3:183117463-183117485 TGAGAAAAGATGCTTTTGGAGGG - Intergenic
966997372 3:185296261-185296283 TGAGATGAGAAGCAACTGAAGGG - Intronic
968351454 3:198057186-198057208 TGAGATAGGAATCTGTTGGAAGG - Intergenic
1202737259 3_GL000221v1_random:16944-16966 TGAGATAGGAATCTGTTGGAAGG + Intergenic
968385205 4:130229-130251 TGCAATAAGAAGCTAATTCATGG + Intronic
970708889 4:18838834-18838856 TGAGATAAAATGTTATTTCAAGG + Intergenic
971061100 4:22970942-22970964 TGAAATGAGAAGCTAGGGCAGGG - Intergenic
971134703 4:23855673-23855695 TGGGATGAGAAGCTATTTAAGGG - Intronic
971460122 4:26886761-26886783 TGAGATGGGGAGCTACTGCAGGG + Intronic
971643531 4:29166312-29166334 TGACATAAGTTGCTATTGCATGG + Intergenic
973384822 4:49500943-49500965 TGAGATAGGAATCTGTTGGAAGG - Intergenic
973861386 4:55068713-55068735 AGAGATAAGGAGCTATTTAACGG - Intergenic
975631029 4:76402461-76402483 TGAGAAAAGCAGCTGTTGCAAGG - Intronic
976364130 4:84214151-84214173 TGAGATGAGAAGTCATTGAAGGG + Intergenic
976533630 4:86185492-86185514 TGAGATAGGAAGACATTGAAAGG + Intronic
978552372 4:109941070-109941092 TGAGAAAAGAATCTATTGGGTGG + Exonic
980314819 4:131185177-131185199 TGAGTCAAAAAGCTATTGGAGGG + Intergenic
980868844 4:138586892-138586914 TGAAATGAGGAGCTATTGAAGGG + Intergenic
981435655 4:144718471-144718493 TGAGATAAGAAGCTATTGCAGGG + Intronic
981623637 4:146732656-146732678 TGAGAGAAGAAAATATTGGAAGG + Intronic
982907802 4:161098983-161099005 TGAACTAAGCAGCTATTGCAGGG - Intergenic
982938036 4:161509928-161509950 TGAGATAAGAAGATCGTGCAGGG + Intronic
982973466 4:162021795-162021817 AGAGATAAGAAGTTATGGCTGGG + Intronic
983031635 4:162810028-162810050 TGACAGAAGAAGCCATTGCTTGG - Intergenic
983600521 4:169521530-169521552 TGCACTAAGAAGTTATTGCAGGG - Intronic
983787813 4:171756434-171756456 TGAGAAAAGAGGCTCTGGCAAGG + Intergenic
984663898 4:182405035-182405057 CCAGGTAAGAAGCTAGTGCAAGG - Intronic
985390084 4:189484216-189484238 AGAGATAAGAGGTTGTTGCACGG + Intergenic
1202768679 4_GL000008v2_random:176274-176296 TGAGATAGGAATCTGTTGGAAGG - Intergenic
986696292 5:10358333-10358355 TGAGATAGGGAGCTATGGGAGGG + Intronic
987429414 5:17814080-17814102 TGAGATAACAAGCATTGGCAAGG - Intergenic
987546669 5:19319375-19319397 TGATAACAGAAGCTAGTGCAGGG - Intergenic
987963603 5:24843120-24843142 TGAGATAAGAAGGCAGAGCATGG + Intergenic
988326620 5:29776859-29776881 AAAGATGAGAAGCAATTGCAAGG - Intergenic
989469282 5:41796281-41796303 TGAGACCAGAAGCTATTCCCAGG - Intronic
989664942 5:43842961-43842983 TGAGTGAAGAAGTTATTGGAGGG + Intergenic
992027200 5:72681825-72681847 AGACATAAGAAGCTATAGCAAGG - Intergenic
992358299 5:76008780-76008802 TGAGATGAGAAGTCATTGCAGGG - Intergenic
993308336 5:86297037-86297059 TGAGGTAGGAAGCTACAGCATGG - Intergenic
994111219 5:96006925-96006947 TTAGATATTTAGCTATTGCAAGG - Intergenic
994891157 5:105638677-105638699 TGCTATAAGAAGCTATTGTCAGG - Intergenic
995034184 5:107514707-107514729 TGAGACAGGAAGCCATTGGAGGG - Intronic
995305506 5:110642867-110642889 TGAGATGGGAGGCTACTGCAGGG + Intronic
995306449 5:110656350-110656372 TGAGAGCAGAAGCTATAGCTAGG - Intronic
996060872 5:119032018-119032040 TGAGATGGGAAGCCATTGGATGG - Intergenic
996831344 5:127743788-127743810 TAGTATAAGAAACTATTGCAGGG + Intergenic
996918437 5:128737893-128737915 TGAGATAGGAAGCCACTGAAGGG - Intronic
997219394 5:132147806-132147828 AGAGATAAGAAGCTGTTGAATGG - Intergenic
997246357 5:132353035-132353057 TGAGATGGGAAGCGATTGGAAGG - Intergenic
997762729 5:136464910-136464932 TCAGATAAAAAGCAATAGCAAGG - Intergenic
997836491 5:137197698-137197720 GGAGATAAGAAGCCATTAAATGG + Intronic
998423605 5:142009260-142009282 TGAAATGAGAAGCTATTGGTGGG - Intronic
998599897 5:143574919-143574941 GGTGATAGGAAGCCATTGCAGGG - Intergenic
999067936 5:148711538-148711560 TGAGATGAAGAGCCATTGCAAGG + Intergenic
1000403504 5:160859814-160859836 TGAGAAAAGAAACTTGTGCAGGG + Intergenic
1000663847 5:163970388-163970410 TGACATAAGTTGCCATTGCAGGG - Intergenic
1000803546 5:165759316-165759338 TGAGGTAAGAAGTTAATGAAAGG + Intergenic
1001975228 5:175993380-175993402 TGAGATGGGAAGCTAATGAAAGG - Intronic
1004739768 6:18447446-18447468 TGGGATGAGAAGCCATTGGAGGG + Intronic
1005020605 6:21414691-21414713 TGGGATAAGAAATTCTTGCAGGG + Intergenic
1009557430 6:65191577-65191599 TGAGATGAAAAGCAATTTCACGG + Intronic
1010101408 6:72112410-72112432 TGAGATGGGAAGCCATTGGAGGG - Intronic
1010183301 6:73113264-73113286 TGAGTGCAGAAGTTATTGCATGG + Intronic
1010923631 6:81716271-81716293 TGAAATAAGAAGACATGGCAGGG + Intronic
1011146009 6:84217639-84217661 TGAAATGAGAAGCTATTAGAGGG + Intronic
1011847664 6:91586557-91586579 CAAGATAAGAAGATGTTGCAAGG - Intergenic
1011928004 6:92672331-92672353 TGAGAAAATAAGGTATTGGAAGG - Intergenic
1012496665 6:99841226-99841248 AGATATAAGAAACTATTGAAAGG + Intergenic
1013398828 6:109771423-109771445 TGAGAAAATAAGTTATTGAAAGG + Intronic
1013854260 6:114552752-114552774 TGAGATAAGAATTAATTGAAGGG - Intergenic
1014073418 6:117209325-117209347 TGAGTTAAAAAGCTTCTGCATGG - Intergenic
1015159456 6:130136260-130136282 TGAGAGATGAAGCTATTGGAAGG - Intronic
1015568482 6:134597999-134598021 TAAGCTAAAAAGCTTTTGCACGG - Intergenic
1016625480 6:146162161-146162183 TGAGATCAGAAGCCATTGTTTGG + Intronic
1016632816 6:146251742-146251764 TGAGATAGGAAGCCATTGAAGGG - Intronic
1016665382 6:146633398-146633420 TGAGATAAGAAGCCAAAGGAGGG - Intronic
1018251166 6:161872135-161872157 TGCGATAAGATGCTATGGAAGGG + Intronic
1020368102 7:7401814-7401836 TGATATAAGAAGTTCTTGAAGGG - Intronic
1020988570 7:15167583-15167605 TGATATAAGAACCTAGTGAATGG - Intergenic
1021309921 7:19081509-19081531 TGAGATATGAAGCAATTCAATGG + Intronic
1022871860 7:34488320-34488342 TGGGAAAAGGAGCTATTTCAGGG - Intergenic
1022911102 7:34900230-34900252 TCAGATGAGATGCCATTGCAGGG + Intergenic
1023306414 7:38833344-38833366 TGAGATAGGAGGCCATTGGAGGG - Intronic
1023409077 7:39870153-39870175 TGAGATAGAAATCTATTGGAAGG + Intergenic
1023453337 7:40311926-40311948 TTAAATAAGGAGCTATTTCAAGG - Intronic
1025043855 7:55673877-55673899 TGAGATAGAAATCTATTGGAAGG - Intergenic
1025136783 7:56422403-56422425 TGAGATAGAAATCTATTGGAAGG - Intergenic
1027567010 7:79807863-79807885 TGAGATGAGAAGCCATTGGAGGG - Intergenic
1027570028 7:79854178-79854200 TGAGACAACAAGCTATTCCTGGG + Intergenic
1027833892 7:83216916-83216938 TGAGATAAATAGATGTTGCAAGG + Intergenic
1028075922 7:86515075-86515097 TGACCTAAGAAGCTATGGCTTGG - Intergenic
1028294086 7:89105730-89105752 TGAGATCAGAAACTATTTCCAGG - Intronic
1030025173 7:105316665-105316687 AAAGATAAGAAACTAATGCAAGG + Intronic
1030412128 7:109193722-109193744 GGAAAGAAGAAGGTATTGCATGG + Intergenic
1030545192 7:110885482-110885504 TTATATTATAAGCTATTGCAGGG + Intronic
1030821123 7:114093083-114093105 AGACATAAGAAGCTTTTGGAAGG - Intronic
1032637408 7:133724970-133724992 TGAATTAAAAAGCTATTGGAAGG + Intronic
1032653437 7:133903236-133903258 TGAAATGAGAAGCCATTACAAGG + Intronic
1032663516 7:134012148-134012170 TGAGGTAGGAAGCTATTAGAAGG + Intronic
1033680541 7:143590576-143590598 TGACATAAAAAGATGTTGCAAGG + Intergenic
1033704353 7:143871236-143871258 TGACATAAAAAGATGTTGCAAGG - Intronic
1035195726 7:157218747-157218769 AGAGCGAGGAAGCTATTGCAGGG + Intronic
1035924494 8:3712505-3712527 AGAAAGAAGAGGCTATTGCAGGG - Intronic
1038139903 8:24833121-24833143 AGAGATAAGAAACCATTGGAGGG + Intergenic
1038556796 8:28525668-28525690 TGAGATGAGAAGCCATTAGAGGG + Intronic
1041545371 8:59036389-59036411 TGAGACAAGAGGCCGTTGCAGGG - Intronic
1042719958 8:71816732-71816754 TGAGATAAGAATCCATCCCAAGG + Intergenic
1043309330 8:78838873-78838895 TGAAAGAAGATGCTATTGCAGGG - Intergenic
1043847900 8:85182160-85182182 TGAGATAAGAAATTATATCATGG + Intronic
1044706563 8:95014498-95014520 TAAGATGAGAAGGTATTGCAAGG + Intronic
1045523983 8:102927936-102927958 TGAGAGGGGAAGCTATTGGATGG + Intronic
1045608473 8:103806564-103806586 TGTGATAAGATACTATTGTAGGG + Intronic
1045760799 8:105604465-105604487 TGTGATGGGAAGCCATTGCATGG - Intronic
1047706530 8:127505067-127505089 TGAAATCAGAAGCTAGTGAAGGG - Intergenic
1048606027 8:135969795-135969817 TGAGACAGGAAGCCATTGGAGGG + Intergenic
1051351830 9:16204718-16204740 TGAGAAAGGAAGCTAAGGCAAGG + Intronic
1051360595 9:16278242-16278264 TGAAATAGGAAGCCATTGCCAGG - Intergenic
1053021787 9:34700216-34700238 TGAGATGGGGAGCTATTGGAAGG + Intergenic
1053660032 9:40266634-40266656 TGAGATAGGAATCTGTTGGAAGG + Intronic
1053910406 9:42895981-42896003 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1054361022 9:64119324-64119346 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1054372163 9:64412933-64412955 TGAGATAGGAATCTGTTGGAAGG + Exonic
1054524566 9:66109583-66109605 TGAGATAGGAATCTGTTGGAAGG - Exonic
1054679782 9:67902636-67902658 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1054943431 9:70769131-70769153 TGTGATGGAAAGCTATTGCAGGG - Intronic
1054962999 9:70990480-70990502 TGAGATAAAAAGGTCTTGAACGG + Intronic
1055278633 9:74648679-74648701 GGAGAGAAGAGGCTAGTGCACGG - Intronic
1056047151 9:82730761-82730783 TGTGATAACATGCTAATGCATGG - Intergenic
1057680571 9:97178711-97178733 TGAGATAGGAATCTGTTGGAAGG - Intergenic
1203693571 Un_GL000214v1:70019-70041 TGAGATAGGAATCTGTTGGAAGG - Intergenic
1203705983 Un_KI270742v1:47394-47416 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1203558021 Un_KI270744v1:18386-18408 TGAGATAGGAATCTGTTGGAAGG - Intergenic
1203642702 Un_KI270751v1:34044-34066 TGAGATAGGAATCTGTTGGAAGG + Intergenic
1186056615 X:5655828-5655850 GGAGAGAAGAAGGTATTTCATGG + Intergenic
1186264341 X:7815620-7815642 TGAGATACAAACCTATTTCAAGG + Intergenic
1188025248 X:25201477-25201499 TGAGACAGGAAGCCATTGGAGGG + Intergenic
1189608212 X:42702876-42702898 TGAGCTAGGAAGCCATTGTAGGG - Intergenic
1190396723 X:49992675-49992697 TGAGTTAAGAAATTATTGCTAGG - Intronic
1191901544 X:66045882-66045904 TGAGATAAGGAACAATTGGAGGG + Intergenic
1192250205 X:69406694-69406716 TACGATAAGAAGCCATTGAAAGG + Intergenic
1192605828 X:72516069-72516091 TGAGATGAGAAGCCATTGGAGGG + Intronic
1192962110 X:76142334-76142356 TGAGATCAGAAGCCATTGCTGGG + Intergenic
1192963423 X:76152753-76152775 TGAGATCAGAAGCCATTGCTGGG - Intergenic
1194275421 X:91875128-91875150 TGAGATAAAAAGGTACTGGAGGG - Intronic
1194482491 X:94443736-94443758 TGATTTAAGAAGCTATGGAAAGG + Intergenic
1194598070 X:95884150-95884172 TGAAATAAGTAGTTATGGCATGG + Intergenic
1194812457 X:98402814-98402836 TGACATAAGAAGCCATTGAAGGG - Intergenic
1195878998 X:109573189-109573211 TGAGATAAGAACCATTTTCAAGG + Intergenic
1196259574 X:113562424-113562446 TGAAATAAGGAAGTATTGCAAGG + Intergenic
1198546534 X:137698125-137698147 GGAGATAAGAAGTGATGGCAGGG + Intergenic
1198793357 X:140369936-140369958 TGAGAGTAGAAGCCATTGAAGGG + Intergenic
1198889159 X:141373740-141373762 TCAATTCAGAAGCTATTGCAAGG + Intergenic
1199059615 X:143339440-143339462 TGAGAAATCAAGTTATTGCATGG - Intergenic
1199426148 X:147703185-147703207 CGAGATAGGAAGCCATTGGAGGG - Intergenic
1199572369 X:149279795-149279817 TGAGATAAGGAGGTATTTGAAGG + Intergenic
1199682854 X:150239449-150239471 GGCCATAAGAAGCTATTGAAAGG + Intergenic
1200373731 X:155757095-155757117 TGAGCTGAGAAGATATTGTAGGG - Intergenic
1200592666 Y:5096539-5096561 TGAGATAAAAAGGTACTGGAGGG - Intronic