ID: 981446541

View in Genome Browser
Species Human (GRCh38)
Location 4:144845777-144845799
Sequence TCCCTTTGGCCCCATTGTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981446541_981446543 8 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
981446541_981446544 9 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206
981446541_981446545 10 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981446541 Original CRISPR TCCCTTTGGCCCCATTGTAA CGG (reversed) Intergenic
No off target data available for this crispr